ID: 1094209035

View in Genome Browser
Species Human (GRCh38)
Location 12:27870926-27870948
Sequence TATATTGTCCAGGATATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094209035_1094209037 -10 Left 1094209035 12:27870926-27870948 CCTTCAATATCCTGGACAATATA No data
Right 1094209037 12:27870939-27870961 GGACAATATAATTATCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094209035 Original CRISPR TATATTGTCCAGGATATTGA AGG (reversed) Intergenic
No off target data available for this crispr