ID: 1094210442

View in Genome Browser
Species Human (GRCh38)
Location 12:27884820-27884842
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094210431_1094210442 24 Left 1094210431 12:27884773-27884795 CCTCTTGCAGACTTTATGGGTTA No data
Right 1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094210442 Original CRISPR CTCTGGGGATGGAGGGCACA AGG Intergenic
No off target data available for this crispr