ID: 1094211923

View in Genome Browser
Species Human (GRCh38)
Location 12:27902001-27902023
Sequence TTAAAATTAGGTTTACAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211923_1094211927 21 Left 1094211923 12:27902001-27902023 CCTAACTGTAAACCTAATTTTAA No data
Right 1094211927 12:27902045-27902067 ATGCTGACCTGCATCTCATGTGG No data
1094211923_1094211929 30 Left 1094211923 12:27902001-27902023 CCTAACTGTAAACCTAATTTTAA No data
Right 1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211923 Original CRISPR TTAAAATTAGGTTTACAGTT AGG (reversed) Intergenic