ID: 1094211924

View in Genome Browser
Species Human (GRCh38)
Location 12:27902013-27902035
Sequence TCATAACTGGGTTTAAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211924_1094211927 9 Left 1094211924 12:27902013-27902035 CCTAATTTTAAACCCAGTTATGA No data
Right 1094211927 12:27902045-27902067 ATGCTGACCTGCATCTCATGTGG No data
1094211924_1094211929 18 Left 1094211924 12:27902013-27902035 CCTAATTTTAAACCCAGTTATGA No data
Right 1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG No data
1094211924_1094211930 24 Left 1094211924 12:27902013-27902035 CCTAATTTTAAACCCAGTTATGA No data
Right 1094211930 12:27902060-27902082 TCATGTGGCTCAGATGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211924 Original CRISPR TCATAACTGGGTTTAAAATT AGG (reversed) Intergenic