ID: 1094211925

View in Genome Browser
Species Human (GRCh38)
Location 12:27902025-27902047
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211925_1094211932 25 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1094211932 12:27902073-27902095 ATGGCTTTGGTAGTCCACGTGGG No data
1094211925_1094211933 26 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1094211933 12:27902074-27902096 TGGCTTTGGTAGTCCACGTGGGG No data
1094211925_1094211931 24 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1094211931 12:27902072-27902094 GATGGCTTTGGTAGTCCACGTGG No data
1094211925_1094211929 6 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG No data
1094211925_1094211930 12 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1094211930 12:27902060-27902082 TCATGTGGCTCAGATGGCTTTGG No data
1094211925_1094211927 -3 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1094211927 12:27902045-27902067 ATGCTGACCTGCATCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211925 Original CRISPR CATGTGTCAACTTCATAACT GGG (reversed) Intergenic