ID: 1094211926

View in Genome Browser
Species Human (GRCh38)
Location 12:27902026-27902048
Sequence GCATGTGTCAACTTCATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211926_1094211929 5 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG No data
1094211926_1094211933 25 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211933 12:27902074-27902096 TGGCTTTGGTAGTCCACGTGGGG No data
1094211926_1094211930 11 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211930 12:27902060-27902082 TCATGTGGCTCAGATGGCTTTGG No data
1094211926_1094211932 24 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211932 12:27902073-27902095 ATGGCTTTGGTAGTCCACGTGGG No data
1094211926_1094211927 -4 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211927 12:27902045-27902067 ATGCTGACCTGCATCTCATGTGG No data
1094211926_1094211931 23 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211931 12:27902072-27902094 GATGGCTTTGGTAGTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211926 Original CRISPR GCATGTGTCAACTTCATAAC TGG (reversed) Intergenic