ID: 1094211928

View in Genome Browser
Species Human (GRCh38)
Location 12:27902052-27902074
Sequence ATCTGAGCCACATGAGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211928_1094211933 -1 Left 1094211928 12:27902052-27902074 CCTGCATCTCATGTGGCTCAGAT No data
Right 1094211933 12:27902074-27902096 TGGCTTTGGTAGTCCACGTGGGG No data
1094211928_1094211931 -3 Left 1094211928 12:27902052-27902074 CCTGCATCTCATGTGGCTCAGAT No data
Right 1094211931 12:27902072-27902094 GATGGCTTTGGTAGTCCACGTGG No data
1094211928_1094211935 25 Left 1094211928 12:27902052-27902074 CCTGCATCTCATGTGGCTCAGAT No data
Right 1094211935 12:27902100-27902122 CTGCTTTATGTCTGTCGTGATGG No data
1094211928_1094211936 29 Left 1094211928 12:27902052-27902074 CCTGCATCTCATGTGGCTCAGAT No data
Right 1094211936 12:27902104-27902126 TTTATGTCTGTCGTGATGGTAGG No data
1094211928_1094211932 -2 Left 1094211928 12:27902052-27902074 CCTGCATCTCATGTGGCTCAGAT No data
Right 1094211932 12:27902073-27902095 ATGGCTTTGGTAGTCCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211928 Original CRISPR ATCTGAGCCACATGAGATGC AGG (reversed) Intergenic