ID: 1094211929

View in Genome Browser
Species Human (GRCh38)
Location 12:27902054-27902076
Sequence TGCATCTCATGTGGCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211926_1094211929 5 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG No data
1094211924_1094211929 18 Left 1094211924 12:27902013-27902035 CCTAATTTTAAACCCAGTTATGA No data
Right 1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG No data
1094211923_1094211929 30 Left 1094211923 12:27902001-27902023 CCTAACTGTAAACCTAATTTTAA No data
Right 1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG No data
1094211925_1094211929 6 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG No data
Right 1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211929 Original CRISPR TGCATCTCATGTGGCTCAGA TGG Intergenic