ID: 1094211930

View in Genome Browser
Species Human (GRCh38)
Location 12:27902060-27902082
Sequence TCATGTGGCTCAGATGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211924_1094211930 24 Left 1094211924 12:27902013-27902035 CCTAATTTTAAACCCAGTTATGA No data
Right 1094211930 12:27902060-27902082 TCATGTGGCTCAGATGGCTTTGG No data
1094211925_1094211930 12 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG No data
Right 1094211930 12:27902060-27902082 TCATGTGGCTCAGATGGCTTTGG No data
1094211926_1094211930 11 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211930 12:27902060-27902082 TCATGTGGCTCAGATGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211930 Original CRISPR TCATGTGGCTCAGATGGCTT TGG Intergenic