ID: 1094211931

View in Genome Browser
Species Human (GRCh38)
Location 12:27902072-27902094
Sequence GATGGCTTTGGTAGTCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211926_1094211931 23 Left 1094211926 12:27902026-27902048 CCAGTTATGAAGTTGACACATGC No data
Right 1094211931 12:27902072-27902094 GATGGCTTTGGTAGTCCACGTGG No data
1094211925_1094211931 24 Left 1094211925 12:27902025-27902047 CCCAGTTATGAAGTTGACACATG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1094211931 12:27902072-27902094 GATGGCTTTGGTAGTCCACGTGG No data
1094211928_1094211931 -3 Left 1094211928 12:27902052-27902074 CCTGCATCTCATGTGGCTCAGAT No data
Right 1094211931 12:27902072-27902094 GATGGCTTTGGTAGTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211931 Original CRISPR GATGGCTTTGGTAGTCCACG TGG Intergenic