ID: 1094211933 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:27902074-27902096 |
Sequence | TGGCTTTGGTAGTCCACGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1094211928_1094211933 | -1 | Left | 1094211928 | 12:27902052-27902074 | CCTGCATCTCATGTGGCTCAGAT | No data | ||
Right | 1094211933 | 12:27902074-27902096 | TGGCTTTGGTAGTCCACGTGGGG | No data | ||||
1094211926_1094211933 | 25 | Left | 1094211926 | 12:27902026-27902048 | CCAGTTATGAAGTTGACACATGC | No data | ||
Right | 1094211933 | 12:27902074-27902096 | TGGCTTTGGTAGTCCACGTGGGG | No data | ||||
1094211925_1094211933 | 26 | Left | 1094211925 | 12:27902025-27902047 | CCCAGTTATGAAGTTGACACATG | 0: 1 1: 0 2: 0 3: 14 4: 131 |
||
Right | 1094211933 | 12:27902074-27902096 | TGGCTTTGGTAGTCCACGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1094211933 | Original CRISPR | TGGCTTTGGTAGTCCACGTG GGG | Intergenic | ||