ID: 1094211935

View in Genome Browser
Species Human (GRCh38)
Location 12:27902100-27902122
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094211934_1094211935 -10 Left 1094211934 12:27902087-27902109 CCACGTGGGGATTCTGCTTTATG No data
Right 1094211935 12:27902100-27902122 CTGCTTTATGTCTGTCGTGATGG No data
1094211928_1094211935 25 Left 1094211928 12:27902052-27902074 CCTGCATCTCATGTGGCTCAGAT No data
Right 1094211935 12:27902100-27902122 CTGCTTTATGTCTGTCGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094211935 Original CRISPR CTGCTTTATGTCTGTCGTGA TGG Intergenic