ID: 1094212043

View in Genome Browser
Species Human (GRCh38)
Location 12:27903113-27903135
Sequence TACAGCCACCACCTTAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094212039_1094212043 -7 Left 1094212039 12:27903097-27903119 CCCTCTTTTTCATCCCTACAGCC No data
Right 1094212043 12:27903113-27903135 TACAGCCACCACCTTAATACAGG No data
1094212037_1094212043 18 Left 1094212037 12:27903072-27903094 CCTTGGAAATGTCTGGGCAATTT No data
Right 1094212043 12:27903113-27903135 TACAGCCACCACCTTAATACAGG No data
1094212040_1094212043 -8 Left 1094212040 12:27903098-27903120 CCTCTTTTTCATCCCTACAGCCA No data
Right 1094212043 12:27903113-27903135 TACAGCCACCACCTTAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094212043 Original CRISPR TACAGCCACCACCTTAATAC AGG Intergenic
No off target data available for this crispr