ID: 1094213979

View in Genome Browser
Species Human (GRCh38)
Location 12:27921341-27921363
Sequence CAGGGGGCCCAGAAATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094213979_1094213986 10 Left 1094213979 12:27921341-27921363 CCTTGCTATTTCTGGGCCCCCTG No data
Right 1094213986 12:27921374-27921396 CCACCTCAGCATCTTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094213979 Original CRISPR CAGGGGGCCCAGAAATAGCA AGG (reversed) Intergenic
No off target data available for this crispr