ID: 1094215161

View in Genome Browser
Species Human (GRCh38)
Location 12:27932765-27932787
Sequence CAACAACCTTTAGCATCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094215161_1094215163 1 Left 1094215161 12:27932765-27932787 CCAGAAGATGCTAAAGGTTGTTG No data
Right 1094215163 12:27932789-27932811 CAAGAAGCCAGGAAGCATCTAGG No data
1094215161_1094215162 -10 Left 1094215161 12:27932765-27932787 CCAGAAGATGCTAAAGGTTGTTG No data
Right 1094215162 12:27932778-27932800 AAGGTTGTTGTCAAGAAGCCAGG No data
1094215161_1094215165 23 Left 1094215161 12:27932765-27932787 CCAGAAGATGCTAAAGGTTGTTG No data
Right 1094215165 12:27932811-27932833 GCACTTCCTAATACACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094215161 Original CRISPR CAACAACCTTTAGCATCTTC TGG (reversed) Intergenic
No off target data available for this crispr