ID: 1094218602

View in Genome Browser
Species Human (GRCh38)
Location 12:27970630-27970652
Sequence CGGGGCAGTCCGCACGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094218602_1094218617 18 Left 1094218602 12:27970630-27970652 CCGAGGGCGTGCGGACTGCCCCG 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1094218617 12:27970671-27970693 GCGCGCCGAGCTGGACGAGCGGG 0: 1
1: 0
2: 1
3: 12
4: 79
1094218602_1094218612 9 Left 1094218602 12:27970630-27970652 CCGAGGGCGTGCGGACTGCCCCG 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1094218612 12:27970662-27970684 CGGTCCCCGGCGCGCCGAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 123
1094218602_1094218609 -4 Left 1094218602 12:27970630-27970652 CCGAGGGCGTGCGGACTGCCCCG 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1094218609 12:27970649-27970671 CCCGGGCAGCCGGCGGTCCCCGG 0: 1
1: 0
2: 1
3: 31
4: 280
1094218602_1094218616 17 Left 1094218602 12:27970630-27970652 CCGAGGGCGTGCGGACTGCCCCG 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1094218616 12:27970670-27970692 GGCGCGCCGAGCTGGACGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094218602 Original CRISPR CGGGGCAGTCCGCACGCCCT CGG (reversed) Intronic