ID: 1094221621

View in Genome Browser
Species Human (GRCh38)
Location 12:28000050-28000072
Sequence GCCTGCATGCAGCTGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094221621_1094221623 7 Left 1094221621 12:28000050-28000072 CCTCTGACCAGCTGCATGCAGGC No data
Right 1094221623 12:28000080-28000102 GCAATACCACTTTTAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094221621 Original CRISPR GCCTGCATGCAGCTGGTCAG AGG (reversed) Intergenic
No off target data available for this crispr