ID: 1094226634

View in Genome Browser
Species Human (GRCh38)
Location 12:28053599-28053621
Sequence GTCCATGTTGTGTAGTCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094226628_1094226634 26 Left 1094226628 12:28053550-28053572 CCCATGTGACTTGATAAGGTTGG No data
Right 1094226634 12:28053599-28053621 GTCCATGTTGTGTAGTCATAGGG No data
1094226630_1094226634 25 Left 1094226630 12:28053551-28053573 CCATGTGACTTGATAAGGTTGGT No data
Right 1094226634 12:28053599-28053621 GTCCATGTTGTGTAGTCATAGGG No data
1094226631_1094226634 -1 Left 1094226631 12:28053577-28053599 CCAAATTAACGTTTTGTACCTTG No data
Right 1094226634 12:28053599-28053621 GTCCATGTTGTGTAGTCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094226634 Original CRISPR GTCCATGTTGTGTAGTCATA GGG Intergenic