ID: 1094227549

View in Genome Browser
Species Human (GRCh38)
Location 12:28062890-28062912
Sequence TTAAGGTAACATTCTCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094227549_1094227556 19 Left 1094227549 12:28062890-28062912 CCCCCCTGAGAATGTTACCTTAA No data
Right 1094227556 12:28062932-28062954 CTTAAAAAAAATTCTTCATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094227549 Original CRISPR TTAAGGTAACATTCTCAGGG GGG (reversed) Intergenic
No off target data available for this crispr