ID: 1094233938

View in Genome Browser
Species Human (GRCh38)
Location 12:28141033-28141055
Sequence CTAGACTCTATGGGAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094233934_1094233938 10 Left 1094233934 12:28141000-28141022 CCAATCATCTTGTTAAGTGGTTC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1094233938 12:28141033-28141055 CTAGACTCTATGGGAAAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094233938 Original CRISPR CTAGACTCTATGGGAAAGAC AGG Intronic
900519073 1:3096971-3096993 CGAGACTCTACTGGAAAGCCTGG - Intronic
901770692 1:11529118-11529140 CTAGATTCTATAGGAAGGAAGGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907224058 1:52928161-52928183 CAAGGCTCTAGGGGAAAGTCAGG - Intronic
907415850 1:54313327-54313349 CTAGACTGTATCAGAAAGAAGGG - Intronic
912621503 1:111164389-111164411 CTAGCCTGGATAGGAAAGACTGG + Intronic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
915466600 1:156102082-156102104 CTAGTCTCTCTGGGACAGGCTGG + Intronic
915645135 1:157265127-157265149 CTAGAATCAATGGGATAGAAGGG + Intergenic
917747027 1:178019928-178019950 TTATGCTCTATGGGAAAGACAGG + Intergenic
918042656 1:180922515-180922537 CTAGACTCTAAGTTAAAGACAGG + Intronic
921502990 1:215929525-215929547 CTGCAGTCTATGTGAAAGACAGG + Intronic
921955577 1:220980227-220980249 TTACAGTCTATTGGAAAGACAGG - Intergenic
1064750135 10:18520126-18520148 CTAGAATTTAGAGGAAAGACTGG - Intronic
1071826882 10:89334191-89334213 CTGGAGTCTGTGGGCAAGACAGG + Intronic
1075435189 10:122434110-122434132 CAAGACCCAATGGGAAAGAAAGG - Exonic
1078934151 11:15937684-15937706 TCAGACTCTCTGGGAGAGACTGG - Intergenic
1080843932 11:36009564-36009586 TTAGACTCTTTAGGAAAGAATGG + Intronic
1081094290 11:38913345-38913367 ATAAGCTCTATGGGAAACACAGG - Intergenic
1082087702 11:48063602-48063624 CTTCCCTCTCTGGGAAAGACTGG - Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1092080100 12:5708944-5708966 TTACAGTCCATGGGAAAGACTGG - Intronic
1094233938 12:28141033-28141055 CTAGACTCTATGGGAAAGACAGG + Intronic
1096642292 12:53004104-53004126 CTTGATTATATGGGAAACACGGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098169903 12:67736764-67736786 CCAGAATCTAGGGGAGAGACTGG + Intergenic
1098988252 12:77035820-77035842 CAAGACACTAGGGGAAAGACTGG + Intronic
1104594702 12:130113220-130113242 CTAGACTTCATTAGAAAGACAGG - Intergenic
1106364190 13:29061555-29061577 CTAGAATGTATGGGACAGAGAGG - Intronic
1107136580 13:36951210-36951232 CTAGACTCTATGGGAAGATGAGG - Intronic
1109590764 13:64477949-64477971 ATATACTATATGGGAAACACTGG + Intergenic
1110491100 13:76109058-76109080 CTAAACTCTATGACAAAAACAGG - Intergenic
1111469664 13:88662061-88662083 TTTGACTCTATAGGAAAAACAGG - Intergenic
1112246877 13:97743359-97743381 CTAGCCTCTCTAGGAGAGACAGG - Intergenic
1112856353 13:103774458-103774480 CTGTTCTCTATGGGAAAGGCAGG + Intergenic
1113594987 13:111524877-111524899 CCAGGCTCTGTGGGAAATACTGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118555884 14:67020898-67020920 CTTTACTCTATGGGAAAAAAAGG - Intronic
1121348362 14:93152985-93153007 CCAGATTATATGGGAAAGGCTGG + Intergenic
1121657346 14:95606871-95606893 TTAGGCTCTATGAAAAAGACTGG - Intergenic
1123215569 14:106806304-106806326 CTAGACACTGAGGGACAGACAGG + Intergenic
1125154237 15:36568135-36568157 CTAGACTCTCTGGGAAGCAGAGG + Intergenic
1126526540 15:49662270-49662292 CTAGAATCAATGGGAAAGATAGG + Intergenic
1131959457 15:97773414-97773436 CTAGACACTATGGGTCAGAAGGG - Intergenic
1133402036 16:5495280-5495302 GCAGACTCTAGAGGAAAGACTGG - Intergenic
1137884190 16:52084982-52085004 CTAGACTATTGGGGAAAGAAGGG - Intergenic
1139435157 16:66932687-66932709 CAGGAGTCTATGGGCAAGACTGG - Intronic
1145728711 17:27156487-27156509 CATGACTCTCTGGGAAAGGCAGG + Intergenic
1148177836 17:45583267-45583289 CTAGTCTCTCTGAGAAAGACAGG + Intergenic
1149336977 17:55645323-55645345 CTACACACTATGGGAGAGGCAGG - Intergenic
1151146551 17:72046818-72046840 CTAGATTCCATGGAAAAGATGGG - Intergenic
1151296530 17:73190507-73190529 ATAGAATCTCTGGGAAAGATGGG + Intergenic
1151980465 17:77505425-77505447 AGAGACTCGATGGGAAAGAGGGG - Intergenic
1153517191 18:5914895-5914917 CTAGGCTCTATGTGAGATACAGG - Intergenic
1155751159 18:29423472-29423494 CAAGAGTCTCTGGGAAAGACCGG - Intergenic
1157347405 18:46852296-46852318 AAAGACTCTTTGGGAAAGGCAGG + Intronic
1159896732 18:74003848-74003870 CTAGACACTCTGGGGAACACAGG - Intergenic
1166563755 19:43750694-43750716 CTGGACTCTATGGGATAGAGCGG - Exonic
1167647790 19:50715263-50715285 CTAGAGTCTATTTCAAAGACAGG - Intronic
927006501 2:18855227-18855249 CTAGGCTGTATGGGATAGAAGGG + Intergenic
927518438 2:23685573-23685595 CTGGGCTCTATGTGAAAGGCCGG - Intronic
927905823 2:26855476-26855498 CTAGATTCTTTTGGAAAGAAAGG + Intronic
934676744 2:96254684-96254706 CCTGACACTCTGGGAAAGACTGG + Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
937384823 2:121419473-121419495 CTAGACACAGTGTGAAAGACTGG - Intronic
939606896 2:144264610-144264632 CCAGAAGCTATGGGAAATACGGG + Intronic
941005096 2:160239803-160239825 TCAGACTCCATGGGAAAGAGAGG + Intronic
941245154 2:163086973-163086995 CAGGGCTCTATGAGAAAGACAGG - Intergenic
943217014 2:185050600-185050622 CTAAACTCTATGGAAAACTCTGG + Intergenic
948661611 2:239510383-239510405 TGAGACTCAAAGGGAAAGACGGG - Intergenic
1169338098 20:4773977-4773999 CTGGCCTCTATGGGAACGAAAGG + Intergenic
1175833371 20:61979022-61979044 AAAGACCCTATGGGAAAGACAGG - Intronic
1181882674 22:25993334-25993356 CTAGCCTCTGTGGCAAAGCCTGG + Intronic
949191326 3:1252738-1252760 CCACACTCAAGGGGAAAGACAGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950255603 3:11502719-11502741 GGAGGCTCTATGGGAAATACTGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
963409929 3:144914062-144914084 CTAGACTTTATGGGATAAAATGG + Intergenic
963919635 3:150893177-150893199 CCAGCCTCTCTGGGACAGACAGG + Intronic
965354420 3:167656103-167656125 CTAGGCTCAAAGGGAAAGAGTGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967224703 3:187279986-187280008 CTGGACACTATGCCAAAGACTGG - Intronic
968083880 3:195865702-195865724 CGAGACAGTATGGGACAGACAGG + Intronic
968083891 3:195865771-195865793 CGAGACAGTATGGGACAGACAGG + Intronic
971766248 4:30835591-30835613 AGAGACTGTATGGCAAAGACTGG + Intronic
972090609 4:35277174-35277196 CTAGACTCTATGGCCCAGAATGG - Intergenic
974355130 4:60802660-60802682 ATGGACTCTATTAGAAAGACAGG - Intergenic
976123477 4:81808027-81808049 CCTGTCTCCATGGGAAAGACAGG - Intronic
977731619 4:100360384-100360406 CTAGAATCTTTGGGAAAGAGTGG - Intergenic
982488579 4:155999684-155999706 GTATATTCAATGGGAAAGACAGG + Intergenic
982764536 4:159329734-159329756 TTAGAAAGTATGGGAAAGACAGG + Intronic
982823582 4:159974816-159974838 CCACACTCCAAGGGAAAGACAGG + Intergenic
983193197 4:164776443-164776465 CTAAACTTTAAGGGCAAGACTGG - Intergenic
988708396 5:33748320-33748342 CTAGAATCTATGGTAAACAGTGG - Intronic
989661248 5:43800048-43800070 CTAGACCCAATGGGTAAGAGAGG - Intergenic
993426845 5:87775931-87775953 CTAGACTCTATTAAAAACACTGG + Intergenic
994647882 5:102492218-102492240 CAGGACTCTATTGGAAAGAATGG + Intronic
999510158 5:152241715-152241737 CTTGACTCTTTGGCAAAGCCAGG + Intergenic
999742037 5:154563277-154563299 GTAGATTCTATTGGAAAAACTGG - Intergenic
1001303625 5:170555731-170555753 GAAGACTCTGTGGGACAGACAGG - Intronic
1004999964 6:21230602-21230624 ATAAACTGTATGAGAAAGACGGG - Intronic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007329869 6:41097794-41097816 CTAGATTCCATGGGAAGGAGTGG - Exonic
1007830284 6:44633083-44633105 GTAGACTATATGGGAATGAATGG + Intergenic
1012476344 6:99618623-99618645 CTAGACTCTGAGGGAAGGACGGG + Intergenic
1012501849 6:99896927-99896949 CTCTACTCTAGTGGAAAGACTGG - Intergenic
1014581909 6:123148098-123148120 CAAGACTGAGTGGGAAAGACAGG - Intergenic
1015049811 6:128826707-128826729 ACCGATTCTATGGGAAAGACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017498093 6:154999136-154999158 TTAAACTTTATGGGAAAGATGGG + Intronic
1023670926 7:42575739-42575761 CAAAACTCTAAGGGAAAGAGAGG + Intergenic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1036695682 8:10973439-10973461 AAAGAATGTATGGGAAAGACTGG - Intronic
1039042444 8:33421005-33421027 GAAGACACTATAGGAAAGACAGG + Intronic
1044547656 8:93477393-93477415 CTATACTCTCTGGGAAACTCAGG + Intergenic
1045309401 8:100987454-100987476 TTAGTCTGTATGGTAAAGACAGG - Intergenic
1047117922 8:121865765-121865787 CTAGACTCTCTGCTAGAGACTGG + Intergenic
1048614231 8:136056860-136056882 CTAGCCCCTATGGGAGAGGCTGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052998471 9:34564411-34564433 CTGGACTCAGTGGGTAAGACTGG + Intronic
1054967459 9:71045771-71045793 CTAAACTCTGTGGGAAGCACCGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056053921 9:82800787-82800809 CTAGTCACTATGTTAAAGACTGG - Intergenic
1058125785 9:101193224-101193246 TTAGACTCCAAGGGAAGGACTGG + Intronic
1187101881 X:16201522-16201544 CTAGACTCTACAATAAAGACAGG - Intergenic
1187370485 X:18701649-18701671 CTAGGCTCTTTGGGAAATAGTGG + Intronic
1189554262 X:42125955-42125977 CTAGACTCAAGGGGAATGAGTGG + Intergenic
1190300758 X:49055712-49055734 CTAGTCTCTATGAGAAATGCAGG - Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1195265395 X:103174706-103174728 CCAGACTCTATGGCATAGAATGG - Intergenic
1197185443 X:123580709-123580731 CTAGGCTCTAACTGAAAGACAGG - Intergenic
1200982009 Y:9271038-9271060 ATAGGCTCTCTGGGAAAGGCAGG + Intergenic
1202128395 Y:21588693-21588715 ATAGGCTCTCTGGGAAAGGCAGG - Intergenic
1202150897 Y:21842764-21842786 ATAGGCTCTCTGGGAAAGGCAGG + Intergenic