ID: 1094244029

View in Genome Browser
Species Human (GRCh38)
Location 12:28266449-28266471
Sequence AGCTTTTACTAGGTGAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094244029 Original CRISPR AGCTTTTACTAGGTGAATTA TGG Intronic
901091087 1:6641980-6642002 ATGTTATACAAGGTGAATTAGGG + Intronic
906022638 1:42644057-42644079 AACTTTTACTTGGTGTATTAGGG + Intronic
906773934 1:48511493-48511515 AGCTTTCACCAGGTGAGTAATGG - Intergenic
906820751 1:48927508-48927530 ACCTGTTTCTAGGTGAAATATGG - Intronic
910292180 1:85609990-85610012 ATATTTTAATATGTGAATTAAGG - Intergenic
911327421 1:96484437-96484459 AGCTTTTACCAAGTGAACTGGGG - Intergenic
911351250 1:96758661-96758683 AGCTTTTACAATGTAAATAAGGG + Intronic
913442732 1:118915999-118916021 AGCTTTTAATGTGAGAATTAGGG + Intronic
915424813 1:155816795-155816817 AGCTTTTACCAGGGCATTTAGGG + Intronic
918358894 1:183734635-183734657 AGCTTTAACTGGCTGAATGAAGG - Intronic
920429432 1:205907327-205907349 AGCTATTACTAAGTAAAATAGGG + Intergenic
920554069 1:206891068-206891090 GGCTGTTACTAAGTGAAATAAGG - Intergenic
1063194257 10:3726516-3726538 AGCTTTGACTAGGCATATTATGG - Intergenic
1064459124 10:15516777-15516799 AGAATTTACAAGGTGAACTAAGG - Exonic
1065769740 10:29066753-29066775 AGCTTTTACAAGGTTATTCATGG + Intergenic
1068447792 10:57145887-57145909 AGCTTTTAATATTTTAATTATGG - Intergenic
1069151870 10:64972376-64972398 AGCTTTTGTTAGGAGAATTATGG - Intergenic
1071050521 10:81442613-81442635 ATTTTTTTCTATGTGAATTATGG + Intergenic
1074679277 10:115887587-115887609 AGGTTTCACTACGTGAATTTAGG + Intronic
1078012597 11:7584521-7584543 TGCTTTTTCTAGGTGAAGAACGG - Intronic
1080161382 11:29180784-29180806 ATCTTTTCCTAGATGAATTAAGG - Intergenic
1081541064 11:44034926-44034948 AGCTTTTACTATGAGCATGATGG - Intergenic
1083007389 11:59359931-59359953 AGATTTTACTAGATGAATATAGG - Intergenic
1085836696 11:79964310-79964332 AGCTTTTAGGAGGTGAATGTTGG + Intergenic
1086416455 11:86593196-86593218 AACTTTTACTATGTGAGTGAAGG - Intronic
1088027367 11:105201915-105201937 AGCTTTTATTAAGTGAAATGTGG - Intergenic
1088035545 11:105309201-105309223 AGCTTTAACTAGAGAAATTATGG - Intergenic
1091026867 11:132149296-132149318 AGCTTCTGCTAGGGGAATTAGGG - Intronic
1093379525 12:18475839-18475861 AGCTATTACTAGGTTAGTTTGGG + Intronic
1094244029 12:28266449-28266471 AGCTTTTACTAGGTGAATTATGG + Intronic
1095454292 12:42366029-42366051 AGTTTTTACCTGGTGATTTATGG + Intronic
1095458644 12:42417627-42417649 TGTTTTTACTTGGTCAATTATGG - Intronic
1096853186 12:54456528-54456550 AGCTTTTACAATGTAAATTAGGG + Intronic
1097362481 12:58672973-58672995 AGCTTTTACTATTTTAATGAGGG + Intronic
1099039958 12:77640297-77640319 AGCAATTTCTTGGTGAATTAAGG + Intergenic
1099329155 12:81260135-81260157 AGCTTTTTCTAAGTACATTATGG - Exonic
1099786809 12:87275032-87275054 AGATTTTACTAGGTGAGTCAGGG - Intergenic
1100114496 12:91287680-91287702 AGCTTTAACTAGATTAACTAAGG + Intergenic
1104132198 12:125905068-125905090 TGCTTTTTCTGGGTGAATTCTGG - Intergenic
1105462181 13:20602530-20602552 GGCTCTTAATAGGTGAAATAAGG - Intronic
1106268330 13:28129915-28129937 AGCTTTGACCATGTGAATAAGGG + Intergenic
1106903724 13:34382737-34382759 AGCCTTTACCAGGTGGATAAGGG + Intergenic
1107268620 13:38587796-38587818 AGTTTTTGCTTGTTGAATTATGG + Intergenic
1110351592 13:74515107-74515129 AGTTTTTACTATATGAATTTTGG - Intergenic
1114199703 14:20508542-20508564 GGCTATTACTAGGTAAAATAAGG - Intronic
1114251739 14:20967791-20967813 AGCTTTTACTTAGTGAAATGTGG + Intergenic
1115542954 14:34439887-34439909 AGGTTTTACTAGGGGGAGTAGGG - Intronic
1119059271 14:71458640-71458662 TGTTTTTACTAGATGTATTATGG + Intronic
1120681724 14:87488130-87488152 AGCTCTTAAAAGTTGAATTAGGG + Intergenic
1121503481 14:94458731-94458753 AGCTGTTCCCAGGAGAATTATGG + Intergenic
1121666132 14:95673733-95673755 AGCTTTTAGGAGGTGGATGATGG + Intergenic
1124017750 15:25892123-25892145 ATCTTTTACTTGCTGACTTAGGG + Intergenic
1124683896 15:31762115-31762137 TACTTTTAGTGGGTGAATTATGG + Intronic
1127939726 15:63682707-63682729 AGCATTTACAAGGTAAATTGTGG - Intronic
1129747026 15:78029638-78029660 AGCTTCTACAATGTGAACTATGG - Intronic
1131997909 15:98149440-98149462 AGCCATTACTAGGTAAAATAAGG - Intergenic
1137368640 16:47883678-47883700 AACTTTTACTGGGTGAATGAAGG - Intergenic
1156753955 18:40497134-40497156 AGCTTTTACAAGGGTGATTAAGG + Intergenic
1158166966 18:54551063-54551085 AGGTTTTCCTATGGGAATTAGGG - Intergenic
1164451184 19:28366438-28366460 AGCTTTATCTATGTGAATTATGG - Intergenic
1164546675 19:29171146-29171168 AAATATTACTAAGTGAATTAAGG + Intergenic
929172918 2:38949338-38949360 AGCTCTAACTTGGTGACTTAAGG - Intronic
935701851 2:105819766-105819788 AAATTTTAATAGGTGAATCAAGG - Intronic
937553390 2:123123678-123123700 AGGTTTTAATAGGTGAAAAAGGG + Intergenic
944920286 2:204405661-204405683 AGCTTTTCCTAGTTGGGTTAGGG - Intergenic
946863672 2:224023730-224023752 ATCTTTTATTAGGTGACTAAAGG + Intronic
946942442 2:224783756-224783778 TTCTTTTAGTAGGTGAGTTAAGG + Intronic
947319708 2:228903388-228903410 AGCATTTACTATGTGAACTGGGG - Intronic
947363001 2:229365112-229365134 AGCTTTTACTAGGTACATATTGG - Intronic
947373546 2:229472822-229472844 AGCTTTTACTAGGTTCATATTGG - Intronic
948927108 2:241106451-241106473 AGTTTTTAGAAGGTGAATTGGGG + Exonic
1169073399 20:2747601-2747623 AGCTTTTCCTATGTGTATAATGG + Intronic
1172831097 20:37835369-37835391 ATCTTTTCCTATGTGTATTAGGG - Intronic
1173275219 20:41574476-41574498 AGCTTTGACTTTGTAAATTAAGG - Intronic
1174993574 20:55540961-55540983 TGATTTTATTAGCTGAATTATGG + Intergenic
1175214482 20:57384469-57384491 AGCTTTCACGAGGTGAACTGGGG + Intergenic
1175441583 20:58996052-58996074 ATTTTTTACTAGGTGACTAATGG - Intronic
1177529791 21:22344273-22344295 AAATTTTTCTAGGTGGATTATGG - Intergenic
1177660860 21:24082031-24082053 AGATTTTAATATGTAAATTATGG - Intergenic
1177707653 21:24728646-24728668 AGCTTTTAGTAGGTGTGTTGTGG + Intergenic
1181935374 22:26434303-26434325 ACCTTTTACTTGGTCAATCAGGG + Exonic
1182108225 22:27704418-27704440 ACAATTTAGTAGGTGAATTATGG + Intergenic
949729998 3:7098123-7098145 AGCTGTTACTAGGGAAATAAGGG - Intronic
951399952 3:22219989-22220011 AGGTTTTACTAAGAAAATTATGG - Intronic
955228024 3:57077214-57077236 AGCCTTGACTTGGTCAATTAGGG - Intronic
956250149 3:67227079-67227101 AGCATTTATTAGGTGAATGTAGG + Intergenic
956996781 3:74835018-74835040 GGATTTAACTAGGAGAATTATGG + Intergenic
958973554 3:100640057-100640079 AGCTTTATCTAAGTGAATGAAGG - Intronic
960281926 3:115789804-115789826 AGGTTTTTCTACGTGAATAATGG - Intergenic
965102636 3:164321010-164321032 TGCTTTTACTATGTTAATTTAGG + Intergenic
967032197 3:185618349-185618371 AGCTTTTGCTAAATGTATTAAGG - Intronic
972308151 4:37852263-37852285 AACTATTACTACATGAATTAAGG - Intronic
973839785 4:54849689-54849711 AACTTTTATGATGTGAATTAAGG + Intergenic
977300572 4:95262531-95262553 AGCTTTTAATAGGAGAAATGAGG - Intronic
978091200 4:104717937-104717959 AGCTTTTTCTCCGTGTATTAAGG - Intergenic
979088567 4:116448309-116448331 ACCTTTAACTATGTGAATTTAGG + Intergenic
980028319 4:127793057-127793079 AGCTTTTACTTTGTGAGATAGGG + Intronic
980924594 4:139122239-139122261 AGATTTTATTTGGTGAATTGGGG - Intronic
981502928 4:145472025-145472047 TGCTTTTGTTAGGTGAATTTAGG + Intergenic
981602640 4:146507866-146507888 AGCTTTCTCTAAGTGAATTACGG + Intronic
983271641 4:165568928-165568950 TGCTTTTACCAGGAGGATTAGGG - Intergenic
984276605 4:177618584-177618606 AGCTTTTTTTAAGTGAAGTAAGG + Intergenic
985116089 4:186592718-186592740 AGCATTGACAAGGTGCATTACGG + Intronic
987876143 5:23684052-23684074 AATTTTTACTAGGTAAATTCAGG + Intergenic
994113238 5:96032264-96032286 AACTTTTCCTAGGTGCATTTTGG - Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
999532948 5:152482477-152482499 ACCTTTCACTAGATGAATTACGG - Intergenic
1000883456 5:166723253-166723275 AGCCATTACTAGGTAAAATAAGG - Intergenic
1008676668 6:53826440-53826462 AGCTTTTAATAGGTTATCTATGG - Intronic
1012021409 6:93925629-93925651 AGCTTTTAGAAGGGGGATTAAGG - Intergenic
1012662129 6:101913528-101913550 ATCTATTAGTAAGTGAATTAAGG + Intronic
1014375898 6:120672965-120672987 AGCTTTTTTTAAGTGAAGTAAGG + Intergenic
1015011532 6:128354984-128355006 AACTTTTACTAGTTGAGTTCTGG - Intronic
1018557381 6:165063390-165063412 ACCTTTTGGTTGGTGAATTACGG + Intergenic
1018585666 6:165355060-165355082 AGATCTCACTTGGTGAATTAAGG + Intronic
1019087630 6:169495541-169495563 AGCTTTAGCCAGGTGGATTAAGG + Intronic
1021243122 7:18229559-18229581 CTCTTTTACTTGGTGAGTTATGG + Intronic
1024476476 7:49817193-49817215 AGCTTTTAACAGATGAATAATGG - Intronic
1028050825 7:86183737-86183759 TTCTTTTAATAGGTGAACTAAGG - Intergenic
1029875686 7:103748933-103748955 AGCTTTTAATGAGTGAATTTTGG + Intronic
1030086018 7:105816395-105816417 AGCTTTTAATAGGCGAAATGGGG + Intronic
1030354004 7:108523171-108523193 AGTTTTAACTAGAGGAATTAAGG + Intronic
1032403307 7:131638491-131638513 AGCGTCTACTAGGTGGATTAGGG + Intergenic
1034783279 7:153901771-153901793 AGCTTTATTTAGGTGAATTCAGG + Intronic
1042482020 8:69314978-69315000 AGTTCTTACTAGATGAATGAAGG - Intergenic
1044624289 8:94221189-94221211 AGATTTTTCTAGGTAAATTTTGG - Intergenic
1044826110 8:96198866-96198888 AGTTTTTACTATGTACATTATGG - Intergenic
1044945209 8:97382952-97382974 AGCTTTTACTCGTGGAATAAGGG + Intergenic
1048298157 8:133230748-133230770 AGATTTAACTTGGTGAATTCAGG - Intergenic
1048469267 8:134692570-134692592 TCCTTTGACTAGGTGAATTTTGG - Intronic
1059621856 9:116014466-116014488 AGCTTTTACTTAAGGAATTACGG - Intergenic
1060310684 9:122458320-122458342 GGTTTTTACTAGTTGAATTGTGG + Intergenic
1186584573 X:10858936-10858958 GGCTTTTAATTGGTGAATTCAGG - Intergenic
1190011856 X:46791957-46791979 ACTTTTTACATGGTGAATTAGGG - Intergenic
1193681486 X:84524918-84524940 ATCTTTTACTAGGGGGATTGCGG - Intergenic
1193719904 X:84974656-84974678 AGCTTTTTCTAAGAGAATTGGGG + Intergenic
1194488083 X:94511438-94511460 GCCCTTTAGTAGGTGAATTATGG + Intergenic
1194834307 X:98661983-98662005 AGAATTAACTAGGTGAATTGGGG + Intergenic
1195850078 X:109273368-109273390 AGCTTTTTCTAGAAGAATTAGGG - Intergenic
1196210203 X:112987435-112987457 AGCTTTTGCATGGAGAATTAAGG + Intergenic
1202059463 Y:20871221-20871243 AACTTTTACAAGGTGAATGTTGG + Intergenic