ID: 1094246166

View in Genome Browser
Species Human (GRCh38)
Location 12:28296570-28296592
Sequence TGTATCTAAGACATCTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094246166 Original CRISPR TGTATCTAAGACATCTAGGT TGG (reversed) Intronic
903791959 1:25899211-25899233 TTCATCTAAGACATTTAGGGAGG - Intronic
906794889 1:48688983-48689005 AGTATCTAGGACATTTAGGCAGG + Intronic
908230184 1:62096916-62096938 AGTATATAAAACATCTATGTTGG - Intronic
908774966 1:67630937-67630959 TGTAAATAAGAGATCTAAGTGGG - Intergenic
910984668 1:92993795-92993817 TGTCTTTCAGACATCTAAGTTGG - Intergenic
916432466 1:164744375-164744397 CGTATCTAAGACATTGTGGTTGG - Intronic
918912348 1:190590924-190590946 TGAAGCTACCACATCTAGGTTGG + Intergenic
919597139 1:199578338-199578360 TGGATCTTATACATCTAGTTGGG + Intergenic
919617869 1:199830108-199830130 TGTCTGTTAGACATCCAGGTGGG - Intergenic
921862733 1:220056157-220056179 TCTCTGTAAGGCATCTAGGTAGG + Intergenic
922635289 1:227163223-227163245 TGTTTCTAAAACATCTATTTTGG + Intronic
1066700893 10:38126886-38126908 TGTATCTAAGCCATGTAGTTTGG + Intergenic
1066990794 10:42511402-42511424 TGTATCTAAGCAATGTAGTTTGG - Intergenic
1068850544 10:61734790-61734812 TTTATCTAACACTTCTAGTTTGG - Intronic
1073935808 10:108630427-108630449 TTTATCAAAGAGATCTGGGTTGG + Intergenic
1078401558 11:11032498-11032520 TCTATCTATGTCATCTAGGCTGG + Intergenic
1080657885 11:34272019-34272041 TGTTTATAATAAATCTAGGTGGG + Intronic
1085054743 11:73397038-73397060 TGTATCTTACACATCTTGATTGG + Exonic
1086243337 11:84721401-84721423 AGTCTCAAAGACATCAAGGTGGG - Intronic
1087017057 11:93564190-93564212 CATATCTAAAACACCTAGGTAGG + Intergenic
1090233390 11:125126895-125126917 TGAACCTAAGGCATCTAGGATGG + Intergenic
1092987695 12:13862511-13862533 TAAATCTAAGACATGTAGCTTGG - Intronic
1093039525 12:14362332-14362354 TGAACTTAAGACTTCTAGGTAGG - Intergenic
1093482792 12:19622575-19622597 TTTATATAAGAAATCTAAGTTGG + Intronic
1094246166 12:28296570-28296592 TGTATCTAAGACATCTAGGTTGG - Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094396912 12:30016874-30016896 TGTGTCTAATACATGTTGGTGGG - Intergenic
1095278867 12:40326039-40326061 TGTATTTGTGACATCTAGGTTGG - Intronic
1098176899 12:67802228-67802250 TGTCTTTAAGATATCTAAGTAGG - Intergenic
1098917359 12:76271464-76271486 TGTGGCTAAGACATCTTTGTTGG - Intergenic
1099298176 12:80857199-80857221 TGAATCTAAGATATCTGGCTTGG - Intronic
1101057957 12:100938972-100938994 TTGATTTAAGACTTCTAGGTTGG - Intronic
1102207874 12:111102821-111102843 TGTAGCTAAAACATTTAGCTTGG + Intronic
1106349399 13:28913584-28913606 TGTATCTCTGATATCTAGTTTGG + Intronic
1107277218 13:38690199-38690221 ATTTTCTAAGACATCTAGATAGG - Exonic
1108183864 13:47868984-47869006 TGTATCTATCACAAGTAGGTAGG + Intergenic
1108982513 13:56536206-56536228 TGTATCTCAGGCATGTATGTAGG + Intergenic
1111208889 13:85050513-85050535 TGGAACTAAGACCTCTAGGCCGG + Intergenic
1114075816 14:19160617-19160639 TGTATCTTAGATATCCAGATAGG + Intergenic
1114086347 14:19238955-19238977 TGTATCTTAGATATCCAGATAGG - Intergenic
1115750328 14:36482988-36483010 TTTAACCAAGGCATCTAGGTTGG - Intronic
1116068299 14:40010716-40010738 TGGAACTAAGACCTCTAGGCCGG - Intergenic
1116105817 14:40503584-40503606 TGTTACTAAGACTTCTAAGTAGG + Intergenic
1120240020 14:81939191-81939213 TGTAACTAAGAAATCAACGTTGG + Intergenic
1120635114 14:86941425-86941447 TGTATCCAAGACATCTGCTTGGG - Intergenic
1202897890 14_GL000194v1_random:20574-20596 TGTATCTTAGATATCCAGATAGG - Intergenic
1125062860 15:35445275-35445297 TGTTGCTAAGACATCTACCTAGG - Intronic
1126386769 15:48101307-48101329 TGTTTCTAACACATTTAGGAAGG - Intergenic
1128386938 15:67156368-67156390 TGACTCTAAGGCCTCTAGGTAGG + Intronic
1129111744 15:73341036-73341058 TGTTACTAAGACAACTTGGTGGG + Intronic
1137663133 16:50227226-50227248 TGTGTCTGTGACATCTAGCTTGG - Intronic
1140867494 16:79076622-79076644 TGTACCTACCACAGCTAGGTAGG + Intronic
1141350992 16:83296648-83296670 TGGATCTCAGCCATCTAGATGGG + Intronic
1142946134 17:3429585-3429607 TAAATCTAAGACATTTTGGTGGG - Intergenic
1147957625 17:44145412-44145434 TGTTTCTAAGACAGTTAAGTAGG - Intronic
1151137642 17:71962761-71962783 TCTATGTAAGACATGTAGTTTGG + Intergenic
1156240868 18:35252609-35252631 GGTATCTCAGACATAAAGGTGGG - Exonic
1157106910 18:44782541-44782563 TGTATGGAAATCATCTAGGTGGG + Intronic
1163161681 19:15468704-15468726 TGTCTCTAAGAGATCCAGGAGGG - Exonic
1168033469 19:53700253-53700275 TGAACCCAAGAGATCTAGGTTGG - Intergenic
1168034264 19:53706479-53706501 TGAACCCAAGAGATCTAGGTTGG - Intergenic
1168037278 19:53730068-53730090 TGAACCCAAGAGATCTAGGTTGG - Intergenic
1168040425 19:53754251-53754273 TGAATCCAAGAGACCTAGGTGGG - Intergenic
926144341 2:10387466-10387488 TGTTTCTGAGCCATCTAGGTGGG + Intronic
931250863 2:60529552-60529574 GGTTACAAAGACATCTAGGTGGG + Intronic
931493513 2:62776410-62776432 TGTATGTAAAGCATCTAGCTTGG + Intronic
931938750 2:67228760-67228782 TCTATCTAAGACAGCCAGGTGGG - Intergenic
932795551 2:74692333-74692355 TGTATTTCAGACAGCTAGTTGGG - Intergenic
938490410 2:131758135-131758157 TGTATCTTAGATATCTAGATAGG + Intronic
940534254 2:154918464-154918486 TGTTTCTAAGTCATCTCAGTTGG + Intergenic
943021198 2:182575642-182575664 TGGAACTAAGACCTCTAGGCTGG - Intergenic
944729954 2:202505962-202505984 TTTGACTAAGACACCTAGGTAGG - Intronic
948204801 2:236157850-236157872 TGAATCTAAGATATCAAAGTAGG + Intergenic
948449212 2:238058480-238058502 TGTATTAGAGACATCTTGGTAGG + Intronic
1170066409 20:12315362-12315384 TTTATCTAAGATATCTATTTGGG - Intergenic
1176998381 21:15581812-15581834 TGGAACTAAGACCTCTAGGCCGG - Intergenic
1180291516 22:10853781-10853803 TGTATCTTAGATATCCAGATAGG + Intergenic
1180494321 22:15883203-15883225 TGTATCTTAGATATCCAGATAGG + Intergenic
953531824 3:43746402-43746424 TGCATGTAAGGGATCTAGGTTGG - Intergenic
956307073 3:67837184-67837206 TGGAACTAAGACCTCTAGGCCGG - Intergenic
956509882 3:69981905-69981927 TGGAACTAAGACCTCTAGGCCGG - Intergenic
957761518 3:84564202-84564224 TGTATGTAAAACATCTACATCGG - Intergenic
958086218 3:88811085-88811107 GGTATGTAAGATATCAAGGTAGG - Intergenic
958523966 3:95228333-95228355 TGTTTCTAATATATTTAGGTAGG + Intergenic
959468718 3:106721808-106721830 TTTATCTAAGACTTGTAGCTTGG + Intergenic
960525082 3:118700709-118700731 TGTAGGTCAGAAATCTAGGTGGG + Intergenic
962936569 3:140086719-140086741 TGTATCTCAGACATGTATTTTGG + Intronic
964470411 3:157047579-157047601 TGTATCTAAGAAATGTTGGCTGG + Intergenic
965514810 3:169609605-169609627 TGTATTTAAGATATGTTGGTAGG + Intronic
966589657 3:181667702-181667724 TGTATCTAAGACCTCAAGTTGGG + Intergenic
969030491 4:4209153-4209175 TGTATCTCAGACACGTAGGCAGG + Intronic
974132991 4:57779321-57779343 TGTATTTCAGACATCTATCTGGG + Intergenic
974243428 4:59282499-59282521 TGGAACTAAGACCTCTAGGACGG + Intergenic
974983856 4:68994597-68994619 TCTCTCTAAGTCATCTAGTTTGG + Intergenic
977143035 4:93399553-93399575 TTCATGTAAGTCATCTAGGTAGG - Intronic
977490850 4:97708091-97708113 TGTATCAAAGACATCAATCTTGG - Intronic
980380526 4:132009038-132009060 TGTATATGAGACATAGAGGTAGG + Intergenic
980423494 4:132594405-132594427 TGTATCTAAACCATAAAGGTAGG + Intergenic
981657656 4:147130380-147130402 TGAATCTAAGACATCATGGATGG + Intergenic
981853516 4:149259408-149259430 TGTATAAAAGACTTTTAGGTGGG + Intergenic
983667860 4:170202238-170202260 TGTATCCAAGCATTCTAGGTGGG - Intergenic
984409830 4:179382826-179382848 GGTATTTAAGAAATCTATGTAGG + Intergenic
984439873 4:179753602-179753624 TGTATTTAAGATTTCCAGGTGGG - Intergenic
988188991 5:27902791-27902813 TGGAACTAAGACCTCTAGGCCGG - Intergenic
988228960 5:28449671-28449693 TGGAACTAAGACCTCTAGGCTGG - Intergenic
988943383 5:36168934-36168956 AGTATTGAAGATATCTAGGTAGG + Intronic
989297032 5:39840863-39840885 GGAATCTAATACATCTAGTTAGG + Intergenic
990694737 5:58403245-58403267 TGTCTCTAAGACATGAATGTAGG - Intergenic
997204072 5:132031338-132031360 TGTATCTGAGACTTCCAGGGAGG + Intergenic
999121296 5:149211446-149211468 TGTTTCTAATTCATCAAGGTGGG - Intronic
999414172 5:151380452-151380474 TGTTTCCAAGTCATCTAGCTAGG - Intergenic
1003363256 6:5448952-5448974 TGTCTATAAGACATCTAGGTAGG + Intronic
1008212671 6:48744065-48744087 TGAATCTTAGACATTTTGGTGGG - Intergenic
1009404213 6:63292246-63292268 TGTATGTTAGAAGTCTAGGTTGG - Intronic
1013754698 6:113447375-113447397 TGTATATAAGACTGCTAGATTGG + Intergenic
1014481809 6:121948454-121948476 TGTATCCCAGACATTTTGGTAGG + Intergenic
1016887749 6:148973714-148973736 TGTATGTAAAACAGCTGGGTAGG - Intronic
1017196258 6:151703822-151703844 TGGATCTAAGACTTCAAAGTGGG - Intronic
1028771467 7:94628282-94628304 TATATCGAAGCCATCCAGGTCGG + Exonic
1030249660 7:107428171-107428193 TTTATATAAGACTTGTAGGTTGG + Intronic
1030957473 7:115872875-115872897 TGTATCCAAGACATCCCTGTGGG + Intergenic
1031493570 7:122419268-122419290 TGTATCTAATACATCAAGGGTGG + Intronic
1036792763 8:11733261-11733283 TGTATTTAAGAAATCTTGCTGGG - Intronic
1039159449 8:34600481-34600503 AATATCTAAGACATCTAGGTTGG + Intergenic
1040991983 8:53362032-53362054 TGTATCCAAGACATCAAAGGGGG + Intergenic
1042415615 8:68514336-68514358 TGCATCTGAGACAGCCAGGTGGG - Intronic
1044431069 8:92107666-92107688 TTTAGATAAGACATCTAAGTAGG - Intergenic
1046635701 8:116673279-116673301 TGTTTCTTAGACATTTAGGGTGG - Intronic
1050912158 9:11085119-11085141 AGTATCTAAGACACCTTGTTAGG - Intergenic
1052238479 9:26242847-26242869 TTTATCTAGCACATCTAGCTTGG - Intergenic
1052296571 9:26902621-26902643 TTTATCTAAGACTTCCAGGAAGG + Intergenic
1054325788 9:63711724-63711746 TGTATCTCAGATATCCAGATAGG + Intergenic
1054349990 9:64012552-64012574 TGTATCTTAGATATCCAGATAGG - Intergenic
1054715627 9:68555519-68555541 TGTATTTAACAACTCTAGGTGGG - Intergenic
1055889679 9:81109367-81109389 TGTATTAATGTCATCTAGGTGGG - Intergenic
1057887444 9:98840661-98840683 TGTATCAAAGACTTCTAGAATGG - Intronic
1058518598 9:105798721-105798743 TGTTTCTAATATATCCAGGTGGG - Intergenic
1060086446 9:120707540-120707562 TTTATCTAAAACCTCTGGGTTGG - Intronic
1186162275 X:6789735-6789757 TTTATTTAAGATACCTAGGTAGG + Intergenic
1186211553 X:7255463-7255485 TTTAATTAAGACATCTTGGTAGG - Intronic
1191741839 X:64444522-64444544 TGTATGTCAGAAATCTAGATGGG + Intergenic
1192680940 X:73253496-73253518 TGTATATAAGACATCTTTTTTGG + Intergenic
1197152931 X:123239674-123239696 AGAATCTAAAACATTTAGGTGGG + Intronic
1197684596 X:129426299-129426321 TGTATCTCATACATTTTGGTAGG + Intergenic
1199072020 X:143488165-143488187 TGTATCTAGGCCATCTGGATTGG + Intergenic
1199926038 X:152465257-152465279 TATATTTAAGACAGGTAGGTTGG + Intergenic
1201150966 Y:11095401-11095423 TGTATCTTAGATATCCAGATAGG - Intergenic
1201584689 Y:15547767-15547789 TTTAATTAAGACATCTTGGTAGG - Intergenic