ID: 1094246221

View in Genome Browser
Species Human (GRCh38)
Location 12:28297416-28297438
Sequence CTTGCTAGTTACCCTTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094246221 Original CRISPR CTTGCTAGTTACCCTTACAA AGG Intronic
910913593 1:92264754-92264776 CTTGCTAATTACCATTACTGTGG - Intronic
911076141 1:93877608-93877630 TCTCCTAGTTACCCTTAAAATGG + Exonic
913554811 1:119954794-119954816 CTTGCTAATGACCCATATAAGGG + Intronic
915049856 1:153057184-153057206 CTTTCTAGTGTCCTTTACAAAGG - Intronic
1068273345 10:54758689-54758711 CTTGGATGATACCCTTACAAAGG + Intronic
1069608491 10:69756325-69756347 CATCCTAGTTACCCTGACATAGG + Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078619855 11:12897306-12897328 CTTGCCAGTTCTCCTTATAAGGG - Intronic
1085887111 11:80533810-80533832 CTGGATACTTACTCTTACAAAGG + Intergenic
1090710517 11:129380664-129380686 CTATTTATTTACCCTTACAATGG - Intronic
1093474414 12:19538877-19538899 CTGGCAAGTTACCCTCCCAAAGG + Intronic
1094246221 12:28297416-28297438 CTTGCTAGTTACCCTTACAAAGG + Intronic
1094463300 12:30722094-30722116 CTTGATAGTTAATCTTAAAATGG + Intronic
1102101746 12:110283611-110283633 CTTGCTAGTTTTCCTAAAAATGG + Intronic
1111052657 13:82905480-82905502 CTTGATAATTACCCTTGAAAAGG + Intergenic
1118255931 14:64205865-64205887 GTTGTTAGTTACCCTTCCACTGG + Intronic
1119333222 14:73810971-73810993 GTTGCTGGTGACCTTTACAAGGG - Intergenic
1121635239 14:95449743-95449765 CTTGCTTGTTACACTGACAAAGG - Intronic
1122093576 14:99355180-99355202 CTTGCTGGTTCCCCTGAAAATGG - Intergenic
1141457681 16:84154794-84154816 CTTGCTGGGTACCCTTACAGAGG - Exonic
1155890054 18:31256489-31256511 CTTGCTAATTACACTTTCAGGGG + Intergenic
930362754 2:50402494-50402516 CTTGCTGATTACCGTTTCAAGGG - Intronic
940153787 2:150631397-150631419 CTTCCTGGTAACCCTTCCAAGGG - Intergenic
941438765 2:165506878-165506900 CTTTCTTGTTACCACTACAAGGG - Intronic
948280666 2:236745504-236745526 CTTGTTAGTTAACCCCACAAAGG - Intergenic
1179200404 21:39213696-39213718 ATGGCTAGTTACGTTTACAAAGG - Intronic
950263391 3:11558371-11558393 CTTGCTTGGTATCCGTACAAGGG - Intronic
952193754 3:31050828-31050850 CTTTCTAGATACACTCACAAAGG - Intergenic
960135162 3:114097291-114097313 GTGGCTAGTTAGTCTTACAAAGG + Intergenic
965304148 3:167043035-167043057 ATTGCCAGTTACCCTTTCCATGG - Intergenic
966549666 3:181190673-181190695 CTTGCTATTTACATTTTCAATGG + Intergenic
970171666 4:13296729-13296751 CTTGCTAGGTAACCTCACAAAGG + Intergenic
974858565 4:67491707-67491729 CTTGCTAGTCATCCTCACAAAGG + Intronic
982794064 4:159624619-159624641 CTTGCTATCTATCCTGACAAAGG - Intergenic
983872341 4:172836478-172836500 ACTCCCAGTTACCCTTACAAAGG + Intronic
987857340 5:23438033-23438055 CTAACTTGTTAGCCTTACAAAGG - Intergenic
989961443 5:50420359-50420381 CTTGATATTTAGTCTTACAATGG + Intronic
995979949 5:118089314-118089336 GTTGCTAATTAGCCTTAAAATGG + Intergenic
998689884 5:144575755-144575777 CTTCCTAGGTGCCCTTACAATGG + Intergenic
999352790 5:150892594-150892616 CTTTCTAGTTAACATTACACTGG - Intronic
1006021838 6:31121945-31121967 CTTGCTAGTGACACTCAGAATGG + Intronic
1011139542 6:84137306-84137328 CATGCTAGCGAGCCTTACAACGG + Intronic
1015535477 6:134263159-134263181 ATTACTAGTTATTCTTACAAGGG + Intronic
1027702176 7:81483328-81483350 ATTGCTAGATAAGCTTACAAGGG - Intergenic
1027702956 7:81491718-81491740 CTTGCTAGTAACCTTTAAGAAGG - Intergenic
1029893626 7:103958313-103958335 CTTACTAGTTTTCCTTACATAGG - Intronic
1032753226 7:134863611-134863633 CTTACTAGTTCCCCTTATAAAGG + Intronic
1034070801 7:148182856-148182878 CTTTCTAGCTACTCTTCCAAGGG + Intronic
1045941286 8:107741278-107741300 CTTGCTAGTTCACCAAACAATGG - Intergenic
1050934155 9:11372866-11372888 CTTGCCAGTGTCCCTTGCAAAGG - Intergenic
1052041314 9:23742042-23742064 CCTTCTAGTTACTTTTACAAAGG - Intronic
1061077168 9:128348673-128348695 CTTCCCAGTTGCCCTGACAAGGG + Exonic
1188519394 X:31020950-31020972 CTTGCTTGTGACTCTTATAAGGG - Intergenic
1197269933 X:124414347-124414369 CTTGCTTGTTTCCCTGGCAAAGG - Intronic
1198579745 X:138049960-138049982 CATGCTAGTTCCCCATGCAATGG + Intergenic