ID: 1094247119

View in Genome Browser
Species Human (GRCh38)
Location 12:28311335-28311357
Sequence CTGTGTCAGAGGAAGCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 394}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094247119_1094247126 14 Left 1094247119 12:28311335-28311357 CCACTCAGCTTCCTCTGACACAG 0: 1
1: 0
2: 5
3: 47
4: 394
Right 1094247126 12:28311372-28311394 AGAGTCTTTTTCCTTTTGGATGG 0: 1
1: 0
2: 3
3: 36
4: 429
1094247119_1094247125 10 Left 1094247119 12:28311335-28311357 CCACTCAGCTTCCTCTGACACAG 0: 1
1: 0
2: 5
3: 47
4: 394
Right 1094247125 12:28311368-28311390 AGAGAGAGTCTTTTTCCTTTTGG 0: 1
1: 0
2: 5
3: 48
4: 461
1094247119_1094247127 15 Left 1094247119 12:28311335-28311357 CCACTCAGCTTCCTCTGACACAG 0: 1
1: 0
2: 5
3: 47
4: 394
Right 1094247127 12:28311373-28311395 GAGTCTTTTTCCTTTTGGATGGG 0: 1
1: 0
2: 2
3: 40
4: 339
1094247119_1094247128 16 Left 1094247119 12:28311335-28311357 CCACTCAGCTTCCTCTGACACAG 0: 1
1: 0
2: 5
3: 47
4: 394
Right 1094247128 12:28311374-28311396 AGTCTTTTTCCTTTTGGATGGGG 0: 1
1: 0
2: 1
3: 66
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094247119 Original CRISPR CTGTGTCAGAGGAAGCTGAG TGG (reversed) Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
901084142 1:6600602-6600624 CTGTGTGAAAGGCAGCTGAAAGG + Intronic
902367798 1:15989008-15989030 CAGAGACAGAGGAGGCTGAGAGG - Intergenic
902713062 1:18253730-18253752 TCCTGTCAGAGGAAGCAGAGAGG - Intronic
902942982 1:19813887-19813909 CAGTGTTAGAGGAAGCGCAGTGG + Intergenic
904961044 1:34333133-34333155 CTGTGTCAGCTGCTGCTGAGAGG - Intergenic
904964214 1:34359186-34359208 TAGTGTCAGAGGAATCTGGGGGG - Intergenic
905319018 1:37102584-37102606 CTGTGTCACAGGATGTTCAGGGG - Intergenic
905441789 1:38000643-38000665 CTGTTCCAGAGGCAGCTGTGTGG - Intronic
906092987 1:43198625-43198647 CTCTGTTAGAGGATGCGGAGAGG + Exonic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
907021008 1:51066847-51066869 CAGTGTGATAGGAAGCTGTGGGG - Intergenic
907080857 1:51620449-51620471 CTGTGATAGAGGAAGCACAGGGG + Intronic
907186342 1:52612264-52612286 CAGTGTCACATGCAGCTGAGAGG - Intergenic
907287491 1:53391082-53391104 CTGGGCCTGAGTAAGCTGAGTGG - Intergenic
908819359 1:68067439-68067461 CTGTATCAGAGTCACCTGAGGGG - Intergenic
909430831 1:75585850-75585872 CTGAGTCAGAAGAAGCTCTGAGG - Intronic
911125018 1:94333356-94333378 CAGGGTCAGAGTCAGCTGAGAGG - Intergenic
911861824 1:102961058-102961080 TTGTGTGAAAGGAAGTTGAGAGG + Intronic
912572126 1:110632394-110632416 CTGGCTCAAAGGCAGCTGAGAGG + Intergenic
912965651 1:114235003-114235025 CTGTGACTGAGGAACCAGAGTGG + Intergenic
916965663 1:169939804-169939826 CTGTGTCAAAACCAGCTGAGAGG + Intronic
920376791 1:205513085-205513107 CTGTGCCAGAGCAAGTGGAGAGG + Intronic
920499841 1:206479168-206479190 CTGTCTCAGAGGAAAATGTGGGG - Intronic
920986750 1:210897819-210897841 ATGGTACAGAGGAAGCTGAGAGG + Intronic
921785702 1:219227308-219227330 CTTTGAAAGAGGAAGCAGAGTGG - Intergenic
921949812 1:220917608-220917630 GTGTTTCAAAGGAGGCTGAGAGG + Intergenic
923012341 1:230098449-230098471 CAAAGTCCGAGGAAGCTGAGAGG + Intronic
923617348 1:235548814-235548836 CTCTGTCAGTGGAAGATGAATGG - Exonic
924294674 1:242573944-242573966 CTATCTCAGAGGAGGCAGAGAGG + Intergenic
1063255257 10:4320671-4320693 CTGTGTTGGAGGAAGATGAGAGG - Intergenic
1063281696 10:4636627-4636649 GAGTGCCAGAGGAAGCTGAATGG - Intergenic
1064014273 10:11760668-11760690 CTGTGTCAGTGGAGGGTAAGTGG + Intronic
1064971058 10:21067649-21067671 CTCTCTCAGATTAAGCTGAGAGG - Intronic
1065566824 10:27019923-27019945 CTGTGTCCAGGGAACCTGAGGGG - Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066105730 10:32155119-32155141 TTGTGTCAGAGGAAGCCTAGTGG - Intergenic
1066363313 10:34751956-34751978 CAAAGTCCGAGGAAGCTGAGAGG - Intronic
1067560519 10:47301420-47301442 CTGTGTCCAGGGAAGCAGAGTGG + Intronic
1069720983 10:70549256-70549278 CACTTTCAGAGGATGCTGAGAGG + Intronic
1069819745 10:71220137-71220159 CAGAGTCAGAAGCAGCTGAGAGG - Intronic
1070497973 10:77041755-77041777 ATGGGTAAGAGGAAGATGAGAGG + Intronic
1070503438 10:77092635-77092657 CAGTGCAGGAGGAAGCTGAGAGG + Intronic
1071144798 10:82556066-82556088 ATGTGTCAAATGAAGCTGTGAGG - Intronic
1071539283 10:86465796-86465818 CAGAGTCCAAGGAAGCTGAGAGG - Intronic
1071862491 10:89688539-89688561 CCAAGTCCGAGGAAGCTGAGAGG + Intergenic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1074242543 10:111653466-111653488 CTGTGTCACATAAAGCTGACTGG - Intergenic
1075175992 10:120161464-120161486 AAGAGTCAGAGGAAACTGAGAGG + Intergenic
1075288360 10:121206650-121206672 CTGTCTCAGAGGTGGATGAGGGG + Intergenic
1075418056 10:122280092-122280114 GTGTGGGAGAGGAGGCTGAGAGG + Intronic
1076065587 10:127445245-127445267 CTGTGCCACAGGAAGGAGAGTGG - Intronic
1076766878 10:132640607-132640629 ATGTGCCCGAGGAGGCTGAGAGG - Intronic
1076832302 10:133001984-133002006 CTGGGGCTGAGGAAGCTGAGAGG + Intergenic
1077614068 11:3662440-3662462 GTGGATCAGAGGAAGCTGGGGGG - Intronic
1078835802 11:15028123-15028145 CTGGGTCACAGGAACCTCAGTGG + Intronic
1079785603 11:24667557-24667579 CTGTGTAATGGGGAGCTGAGTGG + Intronic
1079873127 11:25824876-25824898 CTGAGTCAGAGGATGCAGAGAGG - Intergenic
1080225554 11:29956357-29956379 ATGTGTTAGAGGCAGATGAGAGG - Intergenic
1080677824 11:34444047-34444069 CAAAGTCTGAGGAAGCTGAGAGG + Intronic
1081328196 11:41771592-41771614 CAAATTCAGAGGAAGCTGAGAGG + Intergenic
1081380617 11:42410105-42410127 CTCTGTCAAAGGCACCTGAGAGG + Intergenic
1081617669 11:44600238-44600260 CTGGGTCTGGGGAAGCTGAGGGG - Intronic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1083545534 11:63546272-63546294 CTGTGTTAGAAGCAGCTGTGGGG + Exonic
1084365661 11:68696070-68696092 TGGTGTCAGAGGAAGGTTAGTGG + Intergenic
1084859345 11:72007941-72007963 CACTGACAGAGGAAGATGAGTGG + Intronic
1084908044 11:72363912-72363934 TTCAGTGAGAGGAAGCTGAGAGG - Intronic
1085411781 11:76295670-76295692 CAGTGTCCGAGGAAACCGAGAGG - Intergenic
1085532952 11:77202537-77202559 CTGGGTCAGAGGGAGCTGGAGGG + Intronic
1087385280 11:97462103-97462125 GTGTGTCTGAGGAAACTGAGAGG + Intergenic
1087535996 11:99446185-99446207 CTGTATAAGAGCAATCTGAGAGG - Intronic
1087678973 11:101196949-101196971 CTGTGTCACAGTGAACTGAGGGG - Intergenic
1087928260 11:103945746-103945768 CTCTCTCAGAGAAAGCTGTGGGG + Intronic
1087944022 11:104136150-104136172 CTGTGTACAAGCAAGCTGAGTGG - Intronic
1089759301 11:120711385-120711407 CTGTGGCAGAGGCAGGTGATGGG - Intronic
1089800916 11:121025933-121025955 CTGTGTCTGAGAAATATGAGAGG + Intronic
1089931939 11:122321637-122321659 GTCTCTCATAGGAAGCTGAGTGG + Intergenic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090807348 11:130210660-130210682 CTTTGTCAGAGGAAGATGGGCGG + Intergenic
1091075432 11:132611380-132611402 AGGTGTCACAGGAAGCTGTGTGG - Intronic
1091199414 11:133762528-133762550 TGGTGTCAGAGGAAGCCTAGTGG + Intergenic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1092044259 12:5417609-5417631 ATTTGTAAGTGGAAGCTGAGAGG - Intergenic
1092746552 12:11677900-11677922 CTGTGCCAGAGGACGCTGGGAGG - Intronic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1094334537 12:29333825-29333847 CTGTTTTAGAGGTATCTGAGAGG - Exonic
1094572185 12:31650862-31650884 CTGCGGCCAAGGAAGCTGAGAGG + Intronic
1094727224 12:33132647-33132669 CTGTGACTGAAGAAGTTGAGAGG - Intergenic
1095931865 12:47635617-47635639 ATGTGTCAGTGGAGGCTCAGTGG + Intergenic
1096439981 12:51633128-51633150 CTGTGGAAGAGGGTGCTGAGGGG + Intronic
1096841655 12:54383549-54383571 CAGTGTTTGAGGAAGGTGAGTGG - Intronic
1097430027 12:59493990-59494012 GTGTCTCAGAGGAATTTGAGGGG + Intergenic
1097725842 12:63075147-63075169 CTGTGCCTGAGGAAGCTGCCTGG + Intergenic
1097844817 12:64355381-64355403 CTAAGTCAGAGAAAGTTGAGTGG - Intronic
1100261684 12:92938133-92938155 CAACGTCTGAGGAAGCTGAGAGG - Intergenic
1100396162 12:94188075-94188097 CTGGGTCAGATTCAGCTGAGAGG + Intronic
1101163971 12:102009098-102009120 CTCTGTCAGAGGCAGCAGTGTGG - Intronic
1102012681 12:109628344-109628366 CTCTGTCTCAGGAAGCTTAGGGG + Intergenic
1102105656 12:110320128-110320150 GTGTTTCAGTGGAAGCTCAGAGG - Intronic
1102414235 12:112746805-112746827 CTGAGACAGAGGCAGCTGACTGG - Intronic
1103857862 12:123986544-123986566 CTGTGAGAGATGAAGCTGAGAGG - Intronic
1104039196 12:125118559-125118581 CAGGGACACAGGAAGCTGAGGGG + Intronic
1104395667 12:128430200-128430222 CTGTGTCATACGAAGCGAAGTGG - Intronic
1104475078 12:129064429-129064451 CAGTGTCCAAGGAAGCTGTGGGG + Intergenic
1104823712 12:131693684-131693706 CAGAGTCCGAGGAAGCTGAGAGG + Intergenic
1105211069 13:18257449-18257471 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
1105462581 13:20606269-20606291 TAGTGTCAGAGGAGGCTTAGTGG + Intronic
1106323850 13:28669054-28669076 CTGAGACAGAGCAAGCAGAGAGG - Intronic
1106550559 13:30767360-30767382 CTGAGTCAAAAGAAGCTGAATGG + Intergenic
1106621495 13:31374804-31374826 CTGTGTCAGTGGCAGTTAAGAGG + Intergenic
1106810446 13:33353400-33353422 CTGTGTCAGAGGAAGGAAATGGG - Intergenic
1107258914 13:38467442-38467464 CGGTGTCAGTGGAGGCTAAGTGG - Intergenic
1108140378 13:47415095-47415117 CTCGGTCATAGGAAGCTGTGAGG + Intergenic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1108792718 13:53991728-53991750 CAGTGTAACAGAAAGCTGAGTGG - Intergenic
1110310041 13:74038221-74038243 CTGTGTCTGAGGAATGGGAGGGG + Intronic
1113414947 13:110121517-110121539 CTGTGTCATAGGAGGAAGAGGGG + Intergenic
1113476014 13:110581979-110582001 TGGTGTCAGAGAAGGCTGAGTGG - Intergenic
1113570921 13:111356935-111356957 TTGCATCAGAGAAAGCTGAGGGG - Intergenic
1115213161 14:30988646-30988668 CTTTGTCAGAGAAAAGTGAGAGG - Intronic
1115496926 14:34014098-34014120 CTGTGTTTGAGGAAACTGACGGG + Intronic
1115502876 14:34064916-34064938 CAAAGTCGGAGGAAGCTGAGAGG + Intronic
1115563596 14:34605794-34605816 CTGTGTCTGGGAAAGCTAAGGGG + Intronic
1115864791 14:37732934-37732956 CTGAGGCAGAGGAAGAAGAGGGG + Intronic
1119495348 14:75073573-75073595 CTGTGCCTTTGGAAGCTGAGTGG + Intronic
1119704346 14:76774615-76774637 CTGTGCCTGAGGGAGCTGTGGGG - Intronic
1119778914 14:77265428-77265450 CTGTGCCAGATGAAGCTGCAGGG - Intergenic
1120104415 14:80478034-80478056 GGGTGTCAGATGAAGCTGAAGGG - Intronic
1121141003 14:91541433-91541455 TGGTGTCAAAGGAGGCTGAGTGG + Intergenic
1121339086 14:93094345-93094367 ATGGCTCAGAGGAGGCTGAGAGG + Intronic
1121970644 14:98352904-98352926 CTGTGTCAGAGGAATCTTGGGGG - Intergenic
1122129610 14:99597504-99597526 CTGTGTCAGGGGAGGTTGCGTGG - Intronic
1122322411 14:100863093-100863115 CAGTGTCTGAAGAAGCTCAGAGG + Intergenic
1122823573 14:104359097-104359119 CTGGGGCCGAGGTAGCTGAGTGG + Intergenic
1122998970 14:105281642-105281664 CGGGGTCAGGGGAAGCTGTGTGG + Intronic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1123711201 15:22989035-22989057 CAGTGTCAGAGAAAGGTGTGAGG - Intronic
1124232638 15:27958502-27958524 CTGTGTCAGAGACAGCTCAGTGG - Intronic
1124237354 15:28002277-28002299 CTGGAACAGAGGAAGCTAAGAGG + Intronic
1124342537 15:28899449-28899471 CTGTGGCCCATGAAGCTGAGTGG - Intronic
1126849415 15:52788352-52788374 ATGTGTCAGAGGTACCTGCGAGG + Intronic
1126985905 15:54307646-54307668 AAGTGTCAGAGGAAGCCGATGGG + Intronic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1127905173 15:63371123-63371145 CTGTGTGGGAAGAGGCTGAGAGG + Intronic
1128411863 15:67407477-67407499 CTGTGCCTGAGGAAGATGACAGG + Intronic
1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG + Intergenic
1129239113 15:74241215-74241237 CTCAGTCAGAGGAAGGAGAGGGG + Intronic
1129394230 15:75235544-75235566 CTGTGTCAGAGGCTGGGGAGGGG - Intergenic
1129425951 15:75463005-75463027 CTTTGTCACAGGCTGCTGAGAGG - Intergenic
1130044842 15:80435576-80435598 CTGAGCCAGAGGAATGTGAGAGG - Intronic
1132211509 15:100026766-100026788 CAAAGTCTGAGGAAGCTGAGAGG - Intronic
1132326811 15:100977417-100977439 CGGTGTCAGAGAAGGCTGTGAGG + Intronic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1134486845 16:14665424-14665446 CTAAATCAGAGGAAGCTGAGGGG + Intronic
1136485200 16:30567263-30567285 CTATGACAGAGGAAGCCCAGAGG - Intergenic
1136547512 16:30964105-30964127 CTGTGTCAGAGGAAGAGCGGCGG - Exonic
1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG + Intronic
1138605411 16:58085364-58085386 TTGTGTCAGAGGATGCTGGGCGG - Intergenic
1139022546 16:62768345-62768367 ATGTGGCAGAGGAAGATGATAGG + Intergenic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1139598319 16:67970624-67970646 ATGTGTCTGAGAAATCTGAGGGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141173784 16:81706412-81706434 CTGGGTCAGTGGAGGCAGAGCGG + Intronic
1142375061 16:89702234-89702256 CTGTTTCAGACGAGGCTGAAAGG - Intergenic
1142625552 17:1189549-1189571 ATGTGCCAGATGAAGCTGAAAGG - Intronic
1143002153 17:3801206-3801228 CTGGCTGAGGGGAAGCTGAGTGG - Exonic
1143023611 17:3928982-3929004 TTGAGGCAGAGGAAGCTGAGCGG - Intronic
1143288007 17:5805570-5805592 TGGAGTCAGAGGAGGCTGAGGGG - Intronic
1143845898 17:9772511-9772533 AGGTGGCAGAGGAAGCTGAGTGG + Intronic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144363800 17:14522570-14522592 CTAAGTCAGAGGAAGCTGAGAGG + Intergenic
1144942897 17:18953504-18953526 CTGAGGCCCAGGAAGCTGAGGGG - Intronic
1144957681 17:19027365-19027387 CTGTGGCTCAGGAGGCTGAGGGG - Intronic
1144977476 17:19147151-19147173 CTGTGGCTCAGGAGGCTGAGGGG + Intronic
1146276534 17:31519544-31519566 TTGTGGCTGAGGAAGCCGAGGGG + Intronic
1146509184 17:33431009-33431031 CTATGTGAGAGGATGCAGAGGGG + Intronic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147144414 17:38477017-38477039 CTGTGTCAGATGCCGCTGAGGGG + Intronic
1147408683 17:40233023-40233045 CTCTGTTAGAGTAAGCTGTGGGG + Intronic
1147429019 17:40360274-40360296 CTGAGCCAGAGGAAGGTGACCGG + Intergenic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1147538477 17:41335855-41335877 CAGAGACAGAGGAGGCTGAGAGG + Intergenic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148811063 17:50291662-50291684 CTGTCTCTGAGGAAGCTGTTTGG - Intergenic
1148881567 17:50731905-50731927 CAGAGTCTGAAGAAGCTGAGAGG + Intronic
1150446689 17:65231969-65231991 CTGTGTCAGAGAAGGGAGAGGGG + Intergenic
1151109919 17:71664087-71664109 CTATGTCAGAGGAGGCTAAAAGG - Intergenic
1152697130 17:81803118-81803140 CAGTGTCCCAGGATGCTGAGAGG + Intergenic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1153093960 18:1380318-1380340 CTGTGTCAGATGCAACTGATTGG + Intergenic
1153186821 18:2495233-2495255 CTGTGTGAGAGAAAGTTGAGAGG - Intergenic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1154486098 18:14872334-14872356 CTGTGGCAAAGGAAACAGAGAGG + Intergenic
1155498691 18:26466119-26466141 CTTTCTCAGAGAAAGCAGAGTGG - Intronic
1155925349 18:31650278-31650300 CTGTGTCAGTTGAAGCTCATGGG + Intronic
1157113505 18:44842715-44842737 GTGTGTGGGAGGAAGCTGAAAGG + Intronic
1157426528 18:47588993-47589015 TTGTGTGAGAGGCAGCTGAGTGG + Intergenic
1157446590 18:47751009-47751031 CTGTTTTAAAGCAAGCTGAGGGG + Intergenic
1159929954 18:74300381-74300403 CTGTCTCAAAGGTAGCTGGGAGG + Intergenic
1160409298 18:78664229-78664251 CGGTGGCGGAGGCAGCTGAGCGG - Intergenic
1161199194 19:3005217-3005239 CTGATTCATAGGAAGCTGTGGGG - Intronic
1162018628 19:7858630-7858652 CTGTGTCACAGGCAGCAGACAGG + Intronic
1163114239 19:15179520-15179542 CTGTGTCCCACTAAGCTGAGTGG - Intronic
1163672814 19:18638380-18638402 CTGTTCCTGAGGATGCTGAGTGG + Intronic
1163722691 19:18905793-18905815 CTGGGCCTGAGGAAGCTGAGCGG - Intronic
1164842208 19:31401021-31401043 CTGAGTCAAAGGAAGCTCACAGG + Intergenic
1165333965 19:35156199-35156221 CTGTGTCAGAGGAGAATGGGTGG + Intronic
1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG + Intronic
1166677158 19:44747445-44747467 CTGAGTCACAGGAGGCGGAGAGG - Intergenic
1167500041 19:49840992-49841014 CTCTGTCAGAAGCCGCTGAGAGG + Intergenic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
925162376 2:1694906-1694928 CTGAGACACAGCAAGCTGAGGGG + Intronic
925861012 2:8174885-8174907 ATGTGTCACTGGAGGCTGAGTGG + Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926923978 2:17968239-17968261 CTGTGGCAGAGGATGAGGAGTGG + Intronic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
929670968 2:43876225-43876247 CTGGGGCCGAGGGAGCTGAGAGG - Intronic
930884986 2:56315047-56315069 CTGTGACAGATGAAGCAAAGGGG - Intronic
931273467 2:60723005-60723027 CAAAGTCTGAGGAAGCTGAGAGG + Intergenic
931292657 2:60889244-60889266 CTGTGTCAGTGGAAAAAGAGCGG - Intronic
932268845 2:70391312-70391334 CTGTGACACAGGAAGCTGAGTGG + Intergenic
932634613 2:73377571-73377593 CTGTGAAAGATGAAGCTCAGGGG - Intergenic
932840473 2:75077461-75077483 CTCTTCCAGAAGAAGCTGAGAGG + Intronic
933156317 2:78979526-78979548 CTGTGACACAGGCATCTGAGTGG + Intergenic
934631940 2:95935512-95935534 CTCTTTCAGAGTAAGCTGAATGG + Exonic
934801560 2:97167687-97167709 CTCTTTCAGAGTAAGCTGAATGG - Exonic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
937248442 2:120509159-120509181 CTGTGTCCAATGATGCTGAGAGG + Intergenic
937422799 2:121772563-121772585 ACGTGGCAGAGGAAGCTGAAGGG - Intergenic
938193567 2:129304470-129304492 TAGTGTCAGAGGAAGCCTAGTGG + Intergenic
938227362 2:129627420-129627442 CAGTGGCAGAGGTGGCTGAGAGG + Intergenic
940085099 2:149850339-149850361 CTCTGTCAATGGAAACTGAGAGG + Intergenic
940197445 2:151111378-151111400 GTGTGACAGACGAAGCTAAGAGG + Intergenic
941011888 2:160309306-160309328 CTGTGTCTCAGGAACCTGAATGG + Intronic
941794103 2:169581357-169581379 TTGTGTCAGTGGAAAGTGAGCGG - Intergenic
943984421 2:194602066-194602088 CTGTGTCAGAGTGACCTGAAGGG + Intergenic
944124530 2:196278267-196278289 TTGACTCAGAGGAAGGTGAGAGG - Intronic
944558543 2:200911988-200912010 CAGTGTCAGATGCTGCTGAGAGG - Intronic
945090725 2:206173236-206173258 CAAAGTCTGAGGAAGCTGAGAGG + Intergenic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
947313097 2:228825655-228825677 CTATGTGAGAGGAAGCCTAGAGG - Intergenic
947365869 2:229394447-229394469 CAAAGTCTGAGGAAGCTGAGAGG - Intronic
947639242 2:231697055-231697077 CTGGGGCAGAGGGACCTGAGAGG + Intergenic
948595307 2:239075963-239075985 CTGTTTCCCAGGAAGCTGAGGGG - Intronic
1168787503 20:552514-552536 CTGTGTCAGATGCTGCTGAGGGG + Intergenic
1169049919 20:2567071-2567093 GTGTGCCAGAGGAGGCTGAGTGG + Intronic
1170330811 20:15208765-15208787 CTGGGTCAGTGGAAGCTAACTGG - Intronic
1172296586 20:33815581-33815603 CAGTTTCAGGGGATGCTGAGCGG - Intronic
1172652536 20:36514170-36514192 CAGTGTCAAAGGCAGCTGAAGGG + Intronic
1173132223 20:40404983-40405005 CTGTCTCAGAGGCAGCTGAGAGG + Intergenic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1174213182 20:48896079-48896101 CTGTGTCACATGCTGCTGAGGGG - Intergenic
1174280717 20:49437267-49437289 CTGAGCCAGAGGAAGCTAAGAGG + Intronic
1175010308 20:55728023-55728045 CTGTTGCAGAGGCAGCAGAGAGG - Intergenic
1175507400 20:59495621-59495643 CTGGGTCAGAGGGGACTGAGGGG - Intergenic
1175690548 20:61062778-61062800 CCAAGTCAGAGGAAGCTGAGAGG + Intergenic
1176035063 20:63032122-63032144 CTGGATCAGAGGAGGGTGAGAGG + Intergenic
1176305897 21:5122989-5123011 CTGTCTCAGAGGGTGCAGAGTGG + Intronic
1176795209 21:13367044-13367066 CTGTGGCAAAGGAAACAGAGAGG - Intergenic
1176933410 21:14841201-14841223 GTGTGTCAGAGGGTGCTTAGAGG + Intergenic
1177387592 21:20427765-20427787 GTATGTCAGAGGAAGCAAAGGGG - Intergenic
1179414643 21:41188417-41188439 CAGAGTCCAAGGAAGCTGAGAGG + Intronic
1179475224 21:41638835-41638857 CAAAGTCTGAGGAAGCTGAGAGG + Intergenic
1179851160 21:44139042-44139064 CTGTCTCAGAGGGTGCAGAGTGG - Intronic
1180765176 22:18341987-18342009 CTGTGTGAGATGCTGCTGAGTGG - Intergenic
1180813854 22:18777697-18777719 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
1180964849 22:19782675-19782697 CTGTGGCTGTGCAAGCTGAGTGG + Intronic
1181200039 22:21212032-21212054 CTGTGTGAGATGCTGCTGAGTGG + Intronic
1181441825 22:22940511-22940533 ATGTGTCAGTGGCAGCAGAGTGG - Intergenic
1181701696 22:24624927-24624949 CTGTGTGAGATGCTGCTGAGTGG - Intronic
1182108186 22:27704225-27704247 CTGGGTCTGAGGAGGCAGAGTGG - Intergenic
1183279361 22:36923848-36923870 CAGTGGCAGAGCAAGCTGTGTGG + Intronic
1184549740 22:45198127-45198149 CTGGGCCAGAGGAAGCAGGGAGG - Intronic
1203226797 22_KI270731v1_random:82892-82914 CTGTGTGAGATGCTGCTGAGTGG - Intergenic
1203263953 22_KI270734v1_random:3384-3406 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
949210150 3:1488954-1488976 CTTTGTCAGATGAACCAGAGTGG + Intergenic
949542226 3:5041865-5041887 CTGTGTCAGAGGAAGATCTGGGG + Intergenic
949791617 3:7798665-7798687 CTGTTTCAGGGGAACGTGAGAGG + Intergenic
950014706 3:9747461-9747483 CAGTCTCAGGGGAAGCTGGGTGG + Exonic
950171041 3:10839320-10839342 CTGGGTCAGGGGCAGATGAGAGG - Intronic
950447166 3:13045016-13045038 CTGTGTCTGAGGCTGCTGTGAGG + Intronic
950624872 3:14237797-14237819 CTGTGTTAGACACAGCTGAGTGG + Intergenic
950625352 3:14242665-14242687 TGGTGTCAGCGGAGGCTGAGTGG - Intergenic
952860816 3:37810941-37810963 CAGGGTCAGAGGCAGATGAGGGG - Intronic
953024687 3:39138064-39138086 CAGTGTCTGGGGTAGCTGAGAGG + Intronic
954293861 3:49663524-49663546 CTGTGTCAGAGCCTGCTGTGGGG - Exonic
957625974 3:82652160-82652182 ATGTGTCAGAGGAATCTGAGAGG + Intergenic
958792712 3:98670425-98670447 CAGTGCTAGAGGAAGATGAGTGG - Intergenic
958924584 3:100144330-100144352 TGGTGTCAGAGGAAGCCTAGTGG - Intronic
962283964 3:134071511-134071533 CTATGTCTGAGGAAGTTGAAAGG + Intronic
963666478 3:148194579-148194601 CTGTGAGAGAGGAAGCTGGTTGG + Intergenic
963712961 3:148768315-148768337 AGGTGTCAAAAGAAGCTGAGTGG + Intergenic
963837318 3:150070359-150070381 CTGTGTCCCAGGAAGCCGACTGG + Intergenic
965245041 3:166257545-166257567 GTGTGTCAGAGAAAGCCAAGTGG - Intergenic
965355660 3:167670076-167670098 CAGTGAGAGAGGAAGCTGAAAGG - Intergenic
965922635 3:173937080-173937102 TGGGATCAGAGGAAGCTGAGGGG - Intronic
966145968 3:176812549-176812571 CTGTGTCAGATCAAGTGGAGAGG + Intergenic
966305179 3:178524341-178524363 TTGTGACAGAGGAAAATGAGAGG - Intronic
967097222 3:186186994-186187016 CTGTGTTGGAGGAACCAGAGTGG + Intronic
968667977 4:1831619-1831641 TGGTGTCAGAGAAGGCTGAGGGG - Intronic
969992131 4:11275553-11275575 CTTTGTTAGAGGAAGCCCAGGGG - Intergenic
973615066 4:52670102-52670124 CAAAGTCCGAGGAAGCTGAGAGG + Intergenic
975085648 4:70335471-70335493 CTGTGTCAATGGTAGCTAAGAGG - Exonic
976679989 4:87745799-87745821 GTGTGGGAGGGGAAGCTGAGGGG - Intergenic
978017468 4:103763089-103763111 CTATTTCAGAGTAAGCAGAGAGG + Intergenic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG + Intronic
982545788 4:156731555-156731577 TGGTGTCAGAGAAGGCTGAGTGG + Intergenic
984016425 4:174432396-174432418 CAATGTCCAAGGAAGCTGAGAGG - Intergenic
985428004 4:189848817-189848839 CTATGTCAGAGGCTGCTCAGAGG + Intergenic
985685488 5:1279600-1279622 CAGGGTCTGAGGAAGCTGGGAGG - Intronic
986339936 5:6780263-6780285 CTGTGCCCGATGAAGCTGAAGGG + Intergenic
986944457 5:12998924-12998946 CAGTGCCAGAGAAAGCAGAGAGG - Intergenic
987881740 5:23755627-23755649 TAGTGTCAGAGGAAGCTGAATGG + Intergenic
988993467 5:36693099-36693121 CTCTGGGAGAGGAAGCTGGGTGG - Intergenic
990048123 5:51459773-51459795 TTTTGTCAGAGGAAGCAAAGAGG + Intergenic
990296359 5:54405683-54405705 CTTTGTCAGAAGAGGCTGAGTGG + Intergenic
990730801 5:58806929-58806951 CAGTGTCAAAGGAAGGTAAGTGG + Intronic
992506496 5:77392288-77392310 CAAAGTCTGAGGAAGCTGAGAGG + Intronic
992507254 5:77398931-77398953 CAAAGTCCGAGGAAGCTGAGAGG + Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992742315 5:79785985-79786007 TTGTTTCAGAGGAAAATGAGTGG - Intronic
992836031 5:80642209-80642231 CTGATGTAGAGGAAGCTGAGTGG + Intronic
993539029 5:89125170-89125192 CAAAGTCTGAGGAAGCTGAGAGG + Intergenic
994201955 5:96986700-96986722 CTGTGTCACAAGAGGCTCAGAGG + Intronic
994640237 5:102398521-102398543 CTGTGAAAGATGGAGCTGAGGGG - Intronic
994761490 5:103859914-103859936 CTTTGTAAGAGGGAGCTGGGAGG + Intergenic
995385542 5:111584859-111584881 CTGAGTCAGAGAGAGCTGTGTGG + Intergenic
995785344 5:115821807-115821829 CTGTTTCAGAGGGAGTTCAGGGG + Intergenic
996416680 5:123218021-123218043 CTGTTTCAGAGGAAACTTCGGGG + Intergenic
997407655 5:133664565-133664587 CAGGGTGAGAGGATGCTGAGTGG - Intergenic
997823268 5:137084788-137084810 CTGGGTCAGTGGCAGCTGAGAGG - Intronic
999392211 5:151201648-151201670 GTGCATCAGAGGAGGCTGAGCGG - Exonic
999504635 5:152182009-152182031 CTGAGTCTGTGCAAGCTGAGGGG - Intergenic
999822037 5:155237976-155237998 CTGTGTGGGAGGAAGTTGAAGGG + Intergenic
1000596420 5:163219748-163219770 CTGTGAAAGAGGAAGCTGCTGGG + Intergenic
1001003576 5:168030231-168030253 GTGTGTCAGAAGCAGCTGGGAGG - Intronic
1001449473 5:171813150-171813172 CTGTGTCAGATGAGGTTGACAGG - Intergenic
1002376599 5:178793496-178793518 CAGGGACACAGGAAGCTGAGGGG - Intergenic
1004154483 6:13155435-13155457 CCATGTCTGAGGAAGCTGAGAGG - Intronic
1004258132 6:14083872-14083894 GTGTGTCAGTGGAAGCAGAGTGG - Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006311878 6:33266847-33266869 CTGTCTAAGAGCAAGCTGAATGG + Intronic
1006982994 6:38160695-38160717 CTGTGTCCCAGGACCCTGAGAGG + Intergenic
1007638912 6:43320302-43320324 TTTTGTCAGAGTAAGCTGAATGG + Intronic
1007734625 6:43972831-43972853 CTGAGGCAGAGGGAGCAGAGAGG + Intergenic
1010022213 6:71173781-71173803 TGGTGTCAAAGGAAACTGAGTGG - Intergenic
1012914656 6:105156580-105156602 CTGTCTCAGATGTGGCTGAGAGG - Intergenic
1015882295 6:137881394-137881416 CTGTTGCAGTGGCAGCTGAGGGG - Exonic
1018472133 6:164106536-164106558 CTGTGTCTGAGGATGCTGCAGGG + Intergenic
1019743016 7:2684487-2684509 CTGGGTCAGAGGATGGTGATGGG + Intronic
1020892407 7:13895631-13895653 CTGTGTAACAGGAAGCTAATGGG - Exonic
1021350082 7:19581631-19581653 TTGTGTCAATGGAAGATGAGTGG + Intergenic
1021895463 7:25230961-25230983 CTGTCTGGTAGGAAGCTGAGTGG - Intergenic
1023301927 7:38782356-38782378 CTGTGTGAGAGAAAGCAGAGGGG - Intronic
1026079535 7:67205435-67205457 TGGTGTCAGAAGAAGCTTAGTGG - Intronic
1026697312 7:72606547-72606569 TGGTGTCAGAAGAAGCTTAGTGG + Intronic
1028426655 7:90696942-90696964 TTGTGTCAGATGCTGCTGAGAGG + Intronic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1028941446 7:96526522-96526544 CTGAGTCAAAGGAAGCTGCCAGG - Intronic
1029286374 7:99468691-99468713 CTGGGGCAGGGGAAGCTGAGGGG + Intergenic
1029900340 7:104032554-104032576 CAAAGTCTGAGGAAGCTGAGAGG + Intergenic
1032484635 7:132276209-132276231 CTCTGTCAAAGGAATATGAGTGG + Intronic
1032585657 7:133143911-133143933 CTGTGACAGATGAAGTTCAGAGG + Intergenic
1034165333 7:149021133-149021155 CTCTGTTAGAAGAATCTGAGTGG + Exonic
1034632411 7:152540803-152540825 CAGAGTCCCAGGAAGCTGAGAGG - Intergenic
1034674773 7:152884502-152884524 CTCTGTCACAGGAAGCAGTGAGG - Intergenic
1035307279 7:157941588-157941610 CTGTGTAAGAGTTAGCAGAGAGG + Intronic
1035587257 8:785808-785830 CGGTCTCAGAGGAGCCTGAGGGG - Intergenic
1037665908 8:20969963-20969985 CTGTGGCACAGGAAGGAGAGAGG - Intergenic
1037805591 8:22056527-22056549 CTGTTTAGGAGGAGGCTGAGGGG + Intronic
1038037645 8:23700082-23700104 CTGTGTTAGAAGAGGGTGAGAGG + Intergenic
1038357432 8:26842462-26842484 CTGCGTCTGAGGAATCAGAGTGG - Intronic
1038359257 8:26861134-26861156 CTGTGTCACATGCAGCTGAGAGG - Intronic
1039892537 8:41695003-41695025 ATGTGTGAGAGGATGCTCAGCGG - Intronic
1040030237 8:42817285-42817307 ATCTGTCTGAGTAAGCTGAGCGG + Intergenic
1040655254 8:49500379-49500401 TGGTGTCAGAGGAAGCCAAGTGG - Intergenic
1040914990 8:52559637-52559659 CTGTTTCAGAACCAGCTGAGAGG - Intronic
1041053909 8:53963130-53963152 TTGTGTATGATGAAGCTGAGGGG - Intergenic
1041085433 8:54252144-54252166 ATGTGCCTGAGGGAGCTGAGAGG - Intergenic
1041352354 8:56960403-56960425 CTGTGTCAGAGGGAGAGGGGTGG - Exonic
1041732680 8:61078026-61078048 CTGGGGCGGAGGAAGCCGAGGGG + Intronic
1041893851 8:62901733-62901755 ATGTGTCTGTGGAAGTTGAGAGG - Intronic
1042585506 8:70333737-70333759 CTTTGTTAGAGCAAGCTGATGGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043350574 8:79355603-79355625 ATGTGTCAGTGGCAGCAGAGTGG + Intergenic
1045405846 8:101866177-101866199 CTGTGTCAAATGATGCTGGGAGG - Intronic
1047257548 8:123226991-123227013 CTGTGTGAGAGGAGTCTGATTGG - Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1049194584 8:141308338-141308360 CTGCGTCAGCGGAAGCGGCGCGG - Intergenic
1049325677 8:142020312-142020334 CAGTGGCTGAGGAGGCTGAGGGG - Intergenic
1049633739 8:143674287-143674309 CAAAGTCCGAGGAAGCTGAGAGG - Intergenic
1049960940 9:737512-737534 CTGGGTCACATGAAGCTCAGTGG - Intronic
1049966302 9:783403-783425 CAAAGTCTGAGGAAGCTGAGGGG + Intergenic
1050361958 9:4838601-4838623 CCATGTCAGAGAAAGCTAAGAGG - Intronic
1050418470 9:5438085-5438107 ATGAGGCAGAGGAAGCGGAGTGG + Intergenic
1050455946 9:5834097-5834119 TGGTGTCAGAGGAGCCTGAGAGG - Intergenic
1050822882 9:9904137-9904159 CTGTGTCAGACAAAGATGGGTGG + Intronic
1051468257 9:17405112-17405134 CTGTGTCAAATGCTGCTGAGAGG - Intronic
1052334755 9:27307942-27307964 CAAAGTCTGAGGAAGCTGAGAGG - Intergenic
1052474488 9:28941216-28941238 CAGTGCCAGAGAAGGCTGAGAGG + Intergenic
1053034480 9:34812592-34812614 CTGTCTCTGAGGAAGCAGACTGG + Intergenic
1054338263 9:63828902-63828924 ATGTTTCAGAGGAAGCAGTGGGG + Intergenic
1054892193 9:70262812-70262834 CTCTTTCAGAGGGAGCTCAGAGG + Intronic
1055080633 9:72265039-72265061 CTGCTTCAGAGGAAGGTCAGAGG + Intergenic
1055197218 9:73611056-73611078 CAAAGTCAGAGGAAGCTGAGAGG + Intergenic
1055432471 9:76258027-76258049 CTGTGGAAAAGGGAGCTGAGAGG - Intronic
1055471584 9:76617256-76617278 CTGTCTCTGAGGAAAATGAGAGG + Intronic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1057186372 9:93059377-93059399 CTGTCTCGGAGGAGGCTCAGAGG + Intronic
1057290054 9:93800694-93800716 CAAAGTCAGAGGAAGCTGATAGG + Intergenic
1057810697 9:98254936-98254958 CTGAGTCAGAGGGAGATGAAAGG - Intronic
1060137872 9:121174941-121174963 ATGTATGTGAGGAAGCTGAGCGG + Intronic
1061676233 9:132217349-132217371 CTGTGTCTGGGGGAGCTGTGGGG + Intronic
1061911508 9:133727619-133727641 AGGTGTCAGAGGAACATGAGGGG + Intronic
1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG + Intronic
1062125201 9:134856504-134856526 TAGTGTCAGAGGAAGCTTGGGGG - Intergenic
1062443217 9:136582797-136582819 CTATGTCTCAGGGAGCTGAGAGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186397742 X:9226583-9226605 CTGAGTCACAGGGAGGTGAGAGG + Intergenic
1186655356 X:11605978-11606000 CTGTGAGAGAGGAAGCTAGGTGG + Intronic
1186847796 X:13548323-13548345 CTGTGGCAGAGCAAGCTCTGTGG + Intergenic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1188270939 X:28139681-28139703 TTGTGTCAGAGGAGGCCTAGTGG - Intergenic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1190034234 X:47005673-47005695 TTGTGTTAGAGGAGACTGAGTGG + Intronic
1190152655 X:47960741-47960763 CTGTGTCAGAGAGCTCTGAGGGG + Intronic
1191166924 X:57401432-57401454 AAATGTCAGAGGAAGCAGAGTGG - Intronic
1195309476 X:103616785-103616807 CTGGGACAGAGAAAGCTGGGAGG + Intronic
1195507259 X:105672359-105672381 GGCTGTCAGTGGAAGCTGAGTGG - Intronic
1195630256 X:107048536-107048558 CAAAGTCCGAGGAAGCTGAGAGG + Intergenic
1195845514 X:109223379-109223401 TGGTGTCAGAGGAAGCCTAGTGG + Intergenic
1195845539 X:109223591-109223613 GTGTGTCAAAGGAAGCTGAGTGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1197949682 X:131880959-131880981 TGGTGTCAGAGGAGGCTTAGTGG + Intergenic
1198299163 X:135317650-135317672 CTGTGGTAGAGGCAGCTGGGTGG + Intronic
1198530186 X:137544729-137544751 ATGTGTCAAAGCAAGCAGAGTGG - Intergenic
1198771907 X:140139209-140139231 GTGTGTCAGGGGGTGCTGAGAGG + Intergenic
1199596358 X:149509326-149509348 TAGTGTCACAGGAAGCTCAGGGG + Intronic
1202349105 Y:23968560-23968582 AGGTCTGAGAGGAAGCTGAGAGG + Intergenic
1202521670 Y:25701544-25701566 AGGTCTGAGAGGAAGCTGAGAGG - Intergenic