ID: 1094253418

View in Genome Browser
Species Human (GRCh38)
Location 12:28393641-28393663
Sequence TTAGTTTACTACTTGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094253418 Original CRISPR TTAGTTTACTACTTGCTGCA AGG Intronic
903987800 1:27241583-27241605 TAACTCTACTACTAGCTGCAAGG - Intronic
906671646 1:47659548-47659570 CTAGTTCAGTACTTTCTGCACGG + Intergenic
907134013 1:52122091-52122113 TTAGTTTATTACTTGTTAAATGG + Intergenic
908488539 1:64619230-64619252 TTAGTATACTATATGCTGGAGGG + Intronic
917595956 1:176529386-176529408 TTAGTTTACTAAAGGCTGGAAGG - Intronic
920615209 1:207485767-207485789 TTAGTTTAATATTTGTTGAATGG - Intronic
922843855 1:228667235-228667257 TTATTTAACCACTTGCTCCAAGG - Intergenic
922989551 1:229894748-229894770 TTAGTTTACTAATTCCTGAGAGG + Intergenic
1064046922 10:12025022-12025044 ATAGTTTCCTACCTTCTGCAAGG - Intronic
1066702388 10:38143827-38143849 TTTGTGGACTTCTTGCTGCAAGG - Intergenic
1066990079 10:42504872-42504894 TTTGTGGACTTCTTGCTGCAAGG + Intergenic
1071521425 10:86333485-86333507 TTTGTTCACAGCTTGCTGCAAGG - Intronic
1075341859 10:121653326-121653348 TTTGTTCACTACTTGTTACATGG - Intergenic
1076108422 10:127843267-127843289 TTATTTTGCAACTTGCTTCAGGG - Intergenic
1077800503 11:5531435-5531457 GTAGTTTTCTTCTTGCTGGAAGG + Intronic
1085911616 11:80833660-80833682 TTGCTTTACTGCTTCCTGCAAGG - Intergenic
1087227467 11:95618222-95618244 TTAGTTTAGTGCTTGCTCTAGGG - Intergenic
1087543606 11:99553374-99553396 TTAGGTTCCTACTAGATGCAAGG - Intronic
1088302164 11:108370590-108370612 TAAATTTACTGTTTGCTGCAGGG + Intronic
1089135381 11:116245039-116245061 TTGGTTTGCTCCTTCCTGCAGGG - Intergenic
1090414496 11:126531327-126531349 TTAATTCACCACTTGCTTCAGGG + Intronic
1090564566 11:127974388-127974410 TTGGTTTACTAATTGGTGAAAGG - Intergenic
1093043916 12:14420071-14420093 TAGGTTTACTATTTGCTGCAGGG + Intronic
1094213792 12:27919767-27919789 ATAGTTTAATCCCTGCTGCATGG + Intergenic
1094253418 12:28393641-28393663 TTAGTTTACTACTTGCTGCAAGG + Intronic
1097697992 12:62793391-62793413 TTATTTTGCTCCTTGTTGCAAGG + Intronic
1098199067 12:68035696-68035718 TTAGTTTTCTCCTTTCTGCTAGG + Intergenic
1098323193 12:69272005-69272027 TAACTTTACTACTGGCTGAAAGG - Exonic
1099105936 12:78496443-78496465 TTGTATTACTACTTGCTGCCTGG + Intergenic
1106502883 13:30346384-30346406 GTAGTTTACTACTTGGTTAAGGG + Intergenic
1107022880 13:35769243-35769265 TGAATTTATCACTTGCTGCATGG - Intronic
1107909567 13:45092730-45092752 TTAATTTCCTACTTGTGGCAGGG - Intergenic
1108841824 13:54627144-54627166 TTAGTTTACTCCTTACTAAAAGG + Intergenic
1111534581 13:89586286-89586308 GTAGTTTACAACTTGGAGCAAGG - Intergenic
1111603214 13:90501147-90501169 TATTTTTAGTACTTGCTGCAGGG + Intergenic
1116051894 14:39814222-39814244 TTAGTTCAGTGCTTGGTGCATGG + Intergenic
1116098292 14:40401536-40401558 TAATTTTATTACTTACTGCATGG + Intergenic
1118111922 14:62731450-62731472 TTAGTTAACTCTATGCTGCATGG + Intronic
1118871785 14:69749150-69749172 TTTGTTTCAAACTTGCTGCAAGG - Intronic
1135606513 16:23830255-23830277 TTAGTTTAGTATTTCTTGCATGG + Intergenic
1135748496 16:25037537-25037559 TTGGTTTATTACTTGTTGCAAGG + Intergenic
1135751705 16:25063591-25063613 TTGGTTTATTACTTGTTGCAAGG + Intergenic
1135751810 16:25064370-25064392 TGGGTTTATTACTTGTTGCAAGG - Intergenic
1135758283 16:25116071-25116093 TGGGTTTATTACTTGTTGCAAGG + Intronic
1135779903 16:25291209-25291231 TTAGCTTGCTATTTCCTGCAAGG - Intergenic
1137568150 16:49547057-49547079 AAAGTTTACAACTTTCTGCAGGG - Intronic
1140234781 16:73148427-73148449 ATAGTTTTCAAATTGCTGCATGG - Intergenic
1143583018 17:7837187-7837209 TTACTTTCCCACCTGCTGCATGG + Intergenic
1145242838 17:21249674-21249696 TGAGTGTCCCACTTGCTGCAAGG - Intronic
1146037299 17:29418716-29418738 TCACTGTACTACTTGGTGCATGG + Intronic
1153394124 18:4598643-4598665 TAAGTATACTGCTTTCTGCAAGG + Intergenic
1157850579 18:51045494-51045516 TTAGTTTTCTACCTGTTGAATGG + Intronic
1161118722 19:2513328-2513350 TTATTCTACTACTTGCTTCTAGG + Exonic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1168367200 19:55798647-55798669 TTAGTTTACTTTTAGCTTCAGGG - Intronic
1168368237 19:55808130-55808152 CTACTTTATTTCTTGCTGCATGG - Intronic
1168438590 19:56343391-56343413 TTGGTTCACAAATTGCTGCATGG - Intronic
930261388 2:49150726-49150748 CTAGTTTAGTACTTTCTCCATGG + Intronic
930739672 2:54818149-54818171 TTAGTTTTCTACTTTTTCCAAGG - Intronic
934029894 2:88033862-88033884 TTTGTTTACAACTTCTTGCATGG - Intronic
936162107 2:110091706-110091728 ATAGTATACCCCTTGCTGCAAGG - Exonic
936182555 2:110279648-110279670 ATAGTATACCCCTTGCTGCAAGG + Intergenic
939223251 2:139331103-139331125 TTATTTTAATATTTCCTGCAAGG - Intergenic
941043145 2:160645554-160645576 TTAGTTTGATAATTGCTCCAAGG - Intergenic
943113782 2:183640702-183640724 TTAGTTTTCTTCTTGCAGAAAGG - Intergenic
945333628 2:208566794-208566816 TTAGTTTTCAACTTGCTCTATGG - Intronic
945397320 2:209335396-209335418 TTTGTATAGTGCTTGCTGCAAGG + Intergenic
946323728 2:218971092-218971114 TGTGTTTACTCCTTGCTGCCAGG + Intergenic
947575389 2:231269822-231269844 TTAGTTTTCTTCTCCCTGCACGG + Intronic
1169700177 20:8437143-8437165 TTATTTTACTCCTGGCTACAGGG - Intronic
1169860198 20:10143144-10143166 TTAATTCACTAATTGTTGCATGG - Intergenic
1176692085 21:9926483-9926505 TTGATTTACTATTTGCTTCAAGG - Intergenic
1177571465 21:22892429-22892451 TTGGTGTACTAGTTGGTGCAGGG + Intergenic
1178691635 21:34754877-34754899 ATGGTTTCCCACTTGCTGCAGGG + Intergenic
1179943133 21:44652516-44652538 TCATTTTACTTCTTGCTGAAGGG + Intronic
1184725569 22:46343087-46343109 TTTGTTTATAACCTGCTGCATGG - Intronic
949749258 3:7332091-7332113 TTATTTTACTTAGTGCTGCAAGG - Intronic
950469960 3:13178476-13178498 TTATTTTGCTCCTAGCTGCAGGG + Intergenic
955176603 3:56620707-56620729 TTAGTTTACTTCTTGCTTAGTGG + Intronic
955179149 3:56650360-56650382 TTAGTTGACCACTTTCTCCAGGG + Intronic
956536650 3:70284322-70284344 TTAGTTTACAACTTGGAACAAGG - Intergenic
956769392 3:72511867-72511889 TTCGTTTTCTACTTTTTGCAGGG - Intergenic
959667614 3:108939301-108939323 TTAATATATTACTTGCTTCAAGG + Intronic
959783729 3:110267684-110267706 TAACTTTATTACTTCCTGCAAGG + Intergenic
963046779 3:141108356-141108378 TGAGATCACTTCTTGCTGCAGGG + Intronic
963296829 3:143555775-143555797 TTAGTTTTCTACTGGAGGCAAGG - Intronic
965040073 3:163496129-163496151 TTAGTTTACTTTTTATTGCATGG - Intergenic
966033800 3:175384913-175384935 TTATTTTACTTTTTTCTGCATGG - Intronic
969140699 4:5069020-5069042 TTAGTTTGCAACTTGTTCCATGG + Intronic
969964262 4:10977891-10977913 TTACTTTTCTACTTGCTTCTGGG + Intergenic
970262282 4:14239844-14239866 TTAGTTTAGTATTTTCTGTATGG - Intergenic
970516796 4:16839709-16839731 TTAGTTTAAGACTTCCTACATGG - Intronic
973588566 4:52416937-52416959 TCAGTGTACTTCTTCCTGCACGG - Intergenic
976628560 4:87213435-87213457 TGAATTTACTACTTACTGAAGGG + Intronic
976764799 4:88588941-88588963 TTAGTTTAATCCTTGCTCCTCGG + Intronic
977579727 4:98712011-98712033 TTATTTTACTAGTAGCCGCATGG - Intergenic
978085473 4:104646957-104646979 TTGATTTCTTACTTGCTGCAAGG + Intergenic
980292646 4:130864289-130864311 TTACTTTAATAGTTGCTGTAAGG + Intergenic
980364681 4:131786715-131786737 TTGATTTACTATTTGCTACAAGG - Intergenic
983556703 4:169065600-169065622 ACAGTTTACCACATGCTGCAGGG - Intergenic
987867645 5:23566544-23566566 TAAGTATACTCCTTGCTACAGGG + Intergenic
987933027 5:24427243-24427265 TTATTTTACAACTTGGAGCAAGG - Intergenic
988944263 5:36179566-36179588 TTAGTTTACTACCTCCAGCTTGG - Intronic
989452325 5:41601145-41601167 TTAGGTTACTTCTTCCAGCAAGG - Intergenic
994161983 5:96567222-96567244 TTAATTTACTGCTTTCTGCATGG + Intronic
995383153 5:111558324-111558346 TTAGTTTATTACTTATTGTAAGG + Intergenic
995916270 5:117248879-117248901 TTAGATTCCTTCTTGCTGCATGG + Intergenic
1002822665 6:741057-741079 TGAGATTACTACTTGATACATGG + Intergenic
1003064014 6:2887187-2887209 TTATTTTACTACTTTATGAATGG + Intergenic
1003503347 6:6720352-6720374 TAAGCTTACCACATGCTGCACGG + Intergenic
1004137625 6:12983142-12983164 TTAATTTAATGCTTGCTGCAAGG + Intronic
1007715193 6:43851647-43851669 TTGTTTTTCTACTTGATGCAGGG + Intergenic
1009437339 6:63633641-63633663 TTAGTTTACTGATTACTGTAGGG + Intergenic
1009810351 6:68654446-68654468 TTAATTTCCTACTTGCTCAATGG - Intronic
1010386968 6:75291286-75291308 TTAGTTTATTAATTCCTGCTAGG - Intergenic
1016092006 6:139991283-139991305 TTTGTTTTCTACTTGATACAGGG - Intergenic
1020563740 7:9769743-9769765 TTAATTTAGTAATTGCTCCAGGG - Intergenic
1020822042 7:12982424-12982446 TTACTTTAATACTTGTTGAAGGG + Intergenic
1021438235 7:20646566-20646588 TTAAATTACTACATGCTGAAAGG - Intronic
1022577201 7:31508963-31508985 TTAAATTACTACTAGCTGCGAGG + Intergenic
1030267703 7:107637329-107637351 TAATATTACTACTTGCTTCATGG - Intergenic
1031860727 7:126977034-126977056 TTAGCATACACCTTGCTGCAAGG + Intronic
1032437621 7:131913283-131913305 TTAGTCTACTGCTTTCTGCTGGG - Intergenic
1034682036 7:152936235-152936257 GTAGTTTACAACTTGGAGCAAGG - Intergenic
1037413984 8:18628784-18628806 TTATTTTAGTGTTTGCTGCAAGG - Intronic
1038128608 8:24703285-24703307 TTAGATTACTAGTTGCTTCTTGG - Intergenic
1042405460 8:68400063-68400085 TTAGTTTACTGTTGGATGCATGG + Intronic
1044512390 8:93097568-93097590 TGAGTTTGCTATTTGCTGCTGGG - Intergenic
1046350977 8:113011925-113011947 TTATTTTACTTCTTGCTTTATGG - Intronic
1047424303 8:124731299-124731321 TTGGTTTATAACTTGCAGCAGGG + Intergenic
1048171745 8:132113522-132113544 TAAGTTTACTACTTATAGCAAGG - Intergenic
1050494115 9:6221700-6221722 AGAGGTTACTAGTTGCTGCATGG - Intronic
1051907472 9:22112952-22112974 TCAGTTTACTGCTTGCTGTTTGG + Intergenic
1052017053 9:23481510-23481532 TTAATTTAATATTAGCTGCAAGG - Intergenic
1053629024 9:39912574-39912596 TTGATTTACTATTTGCTACAAGG - Intergenic
1053776744 9:41551001-41551023 TTGATTTACTATTTGCTACAAGG + Intergenic
1054214863 9:62338128-62338150 TTGATTTACTATTTGCTACAAGG + Intergenic
1054364984 9:64327484-64327506 TTGATTTACTATTTGCTACAAGG - Intergenic
1054672617 9:67817221-67817243 TTGATTTACTATTTGCTACAAGG - Intergenic
1056372310 9:85968770-85968792 TTAGATTACTAGTTGGGGCAAGG - Intronic
1058540397 9:106006125-106006147 TTAGTGTAATACTGGCTTCATGG + Intergenic
1058973402 9:110103390-110103412 TTAGTGTCTCACTTGCTGCAAGG - Intronic
1203367092 Un_KI270442v1:268523-268545 TTTGTTTGCTACTTGATTCATGG - Intergenic
1187221441 X:17330414-17330436 TTTGTTTGCTACTTGCTACTTGG - Intergenic
1189273954 X:39771379-39771401 TTAGCATAGTACTTGGTGCATGG + Intergenic
1193429222 X:81379881-81379903 TTAGGGTACTATTTGCTGAAAGG + Intergenic
1195557174 X:106240456-106240478 TGGGTTTACTACTTCTTGCAGGG - Intergenic