ID: 1094257850

View in Genome Browser
Species Human (GRCh38)
Location 12:28455401-28455423
Sequence ACCCCTGGGCTACTAGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094257846_1094257850 29 Left 1094257846 12:28455349-28455371 CCCTAAATTAGTTTCGTTGCAAG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1094257850 12:28455401-28455423 ACCCCTGGGCTACTAGTGATAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1094257847_1094257850 28 Left 1094257847 12:28455350-28455372 CCTAAATTAGTTTCGTTGCAAGA 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1094257850 12:28455401-28455423 ACCCCTGGGCTACTAGTGATAGG 0: 1
1: 0
2: 1
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094257850 Original CRISPR ACCCCTGGGCTACTAGTGAT AGG Intronic
904964762 1:34363102-34363124 GCACCTGGGCTACTTGAGATGGG - Intergenic
910018506 1:82556137-82556159 ACCACTGGCCTACTAGTCCTTGG + Intergenic
912566784 1:110593152-110593174 ACCCCTGGGCCAGCAGTAATGGG + Intergenic
918719840 1:187839073-187839095 GCCCATGGGCTATTTGTGATAGG + Intergenic
1073632041 10:105158819-105158841 ACCCCTGCCCCACTAGAGATGGG - Intronic
1074043977 10:109819930-109819952 GCCCCTGGGCTAATGGTGCTGGG + Intergenic
1075671264 10:124265479-124265501 CCTCCTGGGCTACCACTGATTGG - Intergenic
1079941147 11:26682354-26682376 ACCCCTGGCCTACCAGTAAGTGG + Intronic
1090401899 11:126454348-126454370 TCACCTGGGGTCCTAGTGATGGG - Intronic
1093695903 12:22159968-22159990 ACCCCAGTACTACTAGAGATGGG - Intronic
1094257850 12:28455401-28455423 ACCCCTGGGCTACTAGTGATAGG + Intronic
1106402124 13:29441199-29441221 ACCCCTGGGCTTCTCCTGGTGGG - Intronic
1107981684 13:45740064-45740086 ACCCCTTGGCAACTTGGGATAGG - Intergenic
1113093113 13:106635660-106635682 AGCCCTGGGATACTACTGTTGGG - Intergenic
1119537802 14:75417147-75417169 ACCCCAGGGCTACTTGTGGTTGG - Intergenic
1123936930 15:25198568-25198590 ACCCCTTGCCTATTGGTGATTGG + Intergenic
1127370548 15:58334845-58334867 TCCCCTGGGCTGCTTGTGGTGGG + Intronic
1139072286 16:63397376-63397398 CCCCCTTGGCTGCTAGAGATGGG + Intergenic
1144034685 17:11354599-11354621 AGCCCTGGGCATCTAGAGATTGG + Intronic
1147317598 17:39628163-39628185 ACCCCTGCTCCACTAGGGATGGG - Intronic
1150712432 17:67543352-67543374 AGCCCTGGGCTACCAGTGAATGG + Intronic
1151372360 17:73656284-73656306 ACCCCTGGGCAAGCAGTGATGGG - Intergenic
1152071320 17:78135117-78135139 TCCCTTGGGCCACTAGTGAAGGG - Intronic
1152766865 17:82146092-82146114 ACCCCTGGGCCACCGGTGCTGGG + Intronic
1153120218 18:1715206-1715228 ACAAATGGGCTACTATTGATGGG - Intergenic
1160973955 19:1783360-1783382 AGCCCTTGGCCACTATTGATTGG + Intronic
1161532659 19:4799513-4799535 ACTCCTGGGCTACTAGGATTGGG - Exonic
1162121318 19:8470947-8470969 TCCTTTGGGCTACTAGGGATTGG + Intronic
1162721836 19:12667176-12667198 ACCCCTGGAGTACCAGGGATGGG + Intronic
1165070340 19:33251775-33251797 ACTCCTGGGCTACTTGTGATGGG + Intergenic
1167446190 19:49539035-49539057 ACCCCTGGGGTAAGAGTGAGAGG - Intronic
925256274 2:2491291-2491313 ACTCCTGGGGCACTAGTGAAGGG + Intergenic
941472270 2:165902929-165902951 ACCCCTGAGGTGCTAGGGATGGG - Intronic
948180506 2:235976144-235976166 ACCCTTGGGCTGTCAGTGATGGG + Intronic
1168762695 20:360247-360269 TCCCCTGGGCCAGTAGGGATGGG - Intergenic
1168928342 20:1600863-1600885 ACCCCAGGGCTGGTAGTGAATGG + Intronic
1177019763 21:15839302-15839324 AGCTGTGGGCCACTAGTGATGGG + Intronic
1177320418 21:19513166-19513188 CCCACCGGGCTACTAGTGACAGG - Intergenic
1179179000 21:39029445-39029467 AGCCCTGGGCTCTCAGTGATTGG + Intergenic
1179335414 21:40447090-40447112 ACCCCTGTGCTGCTAGGGAAGGG - Intronic
1182661346 22:31927374-31927396 ACCCCTGGGCAACTGGTGGCGGG - Intergenic
951600531 3:24369832-24369854 ACCCTTGGGCTACTAGGTATTGG - Intronic
954045637 3:47927435-47927457 AGCTCTGGGCTACTACAGATAGG + Intronic
954640943 3:52097366-52097388 ACCCCTGGGCTGCTTCAGATAGG + Intronic
962850671 3:139306360-139306382 TCCCCTGGGGTACTGGGGATGGG + Intronic
969670588 4:8587944-8587966 ACCCCTAGGCTTCCAGAGATGGG - Intronic
972725460 4:41743407-41743429 ACCCCTGGTTTATGAGTGATGGG - Intergenic
977458851 4:97299364-97299386 ACTCCTGGGCTACAAGATATGGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
983061166 4:163162372-163162394 ACCACTGTGCTGCTAGAGATAGG - Intronic
990001381 5:50897472-50897494 ACCCCTGGGCTCCTTTTGAGTGG - Intergenic
992980591 5:82167126-82167148 AGTCTTGGGCTACTAGTAATTGG - Intronic
993435987 5:87894999-87895021 ACCCTTGGGCCACTATTCATGGG + Intergenic
993561340 5:89414520-89414542 AACCTTTGGCTACTAATGATTGG + Intergenic
996142470 5:119929130-119929152 CCCACTTGGCTACCAGTGATGGG + Intergenic
999569500 5:152902912-152902934 ACTACTGGGATACTAGGGATAGG + Intergenic
1002327267 5:178418003-178418025 AGCCCTGGGCTGCCAGTGAGTGG + Intronic
1011626441 6:89287154-89287176 ACCCCTGGACTACAAGTCACAGG - Intronic
1013612525 6:111808323-111808345 CCCCCTGGGCTAGTATTGAGGGG + Intronic
1016107067 6:140175916-140175938 ACCCCAGGGCTATTGGTGAGTGG - Intergenic
1022591380 7:31667006-31667028 ACCCCTGTTCTATTAGGGATAGG + Intergenic
1027515212 7:79133857-79133879 ACCCCTGGAGTACTAGGCATGGG - Intronic
1035684991 8:1517395-1517417 ACCCCTGGGCGCCCAGTGCTTGG + Intronic
1036102083 8:5798601-5798623 ACCCTTTGGCCACTAGTGACGGG - Intergenic
1042159815 8:65881401-65881423 AGCCCTGGGCCAATAGTGCTGGG + Intergenic
1057265289 9:93613407-93613429 AACCCTGGGTAATTAGTGATGGG + Intronic
1059612620 9:115915629-115915651 ACTCCTGATCTACAAGTGATAGG - Intergenic
1187001117 X:15179364-15179386 GCCCCTGAGCTTCTAGTGGTAGG - Intergenic
1189117927 X:38362464-38362486 TCCCTTGGACTACAAGTGATTGG - Intronic
1195502778 X:105621845-105621867 ACACCTCAGGTACTAGTGATGGG + Intronic
1198579715 X:138049674-138049696 AACCCTGGGGGACTAGTAATGGG - Intergenic