ID: 1094261626

View in Genome Browser
Species Human (GRCh38)
Location 12:28507358-28507380
Sequence CACCAAATGCTGCTACAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094261626 Original CRISPR CACCAAATGCTGCTACAGAT GGG (reversed) Intronic
902048680 1:13544751-13544773 CACCAAATGATCCCACACATTGG - Intergenic
904302224 1:29561671-29561693 CCCCAAGGGCTGCTACAGAGAGG - Intergenic
909814872 1:79979216-79979238 CGCTAAATGTTGCTAAAGATAGG + Intergenic
910590523 1:88924744-88924766 CACCCATTGCTGCTCCCGATTGG + Intergenic
912229116 1:107771855-107771877 CTGAAAATGCTGCCACAGATGGG + Intronic
912463387 1:109852498-109852520 CACCCATTGCTGCTCCTGATCGG - Intergenic
916014635 1:160739080-160739102 TACCAAATGCTGATGAAGATGGG + Intronic
916483960 1:165241206-165241228 CACCTCATGGTGGTACAGATAGG - Intronic
917056552 1:170988339-170988361 CTCTCAATGCTGCTGCAGATGGG + Intronic
921891756 1:220360777-220360799 CAACATCTGCTGCTATAGATAGG + Intergenic
922497460 1:226070095-226070117 CAACAAATGCTGTTACAAATTGG + Intronic
923245635 1:232129253-232129275 CTCCACATGCTGATACTGATAGG + Intergenic
1063091629 10:2870444-2870466 AAGCAAATGTTACTACAGATAGG - Intergenic
1067151603 10:43739664-43739686 AATGAAATTCTGCTACAGATAGG - Intergenic
1067203067 10:44191478-44191500 CACCAAATGCTGGCAAGGATGGG + Intergenic
1067789957 10:49280286-49280308 TACCTAATGCTGCCAAAGATGGG + Intergenic
1068504945 10:57888748-57888770 CACCAAATACTGCTCCATATTGG + Intergenic
1070969748 10:80553531-80553553 CACCAAGTCCTGCTACACGTGGG + Intronic
1078149336 11:8745354-8745376 CACCAAAATCAGGTACAGATAGG - Intronic
1078459361 11:11501903-11501925 CAGCAAATGCAGCTTCAGAGAGG + Intronic
1084504697 11:69558034-69558056 CACCGAATAATGATACAGATTGG - Intergenic
1085591968 11:77771470-77771492 TACAAGATGCTGCTACAGAAGGG + Intronic
1086747687 11:90450809-90450831 GACCAAATGTGGCTACTGATTGG + Intergenic
1089364607 11:117913822-117913844 TTCCAGTTGCTGCTACAGATGGG + Exonic
1091953064 12:4611330-4611352 AACCAACTGCTGAGACAGATGGG + Intronic
1092469907 12:8768229-8768251 CACCCATTGCTGCTCCTGATCGG - Intronic
1093125122 12:15319484-15319506 CACCAATTGCTTCTACATATTGG - Intronic
1094261626 12:28507358-28507380 CACCAAATGCTGCTACAGATGGG - Intronic
1096351217 12:50902763-50902785 CACCCATTGCTGCTCCGGATCGG - Intergenic
1097376728 12:58852130-58852152 CACCCATTGCTGCTCCGGATTGG - Intergenic
1099666186 12:85632228-85632250 TCCCATATGCTGCTACCGATAGG - Intergenic
1103872323 12:124100744-124100766 CACCCATTGCTGCTCCCGATGGG - Intronic
1108965990 13:56302506-56302528 CAGCAAATGGTCCTACTGATTGG - Intergenic
1111090500 13:83439682-83439704 CACCCATTGCTGCTCCTGATTGG + Intergenic
1113918451 13:113889165-113889187 TACCAATTGCTTCTATAGATTGG + Intergenic
1115171210 14:30509485-30509507 CATCAAAGGCTGATACAGACGGG + Intergenic
1117396794 14:55318805-55318827 CACCAGATCCAGCTACTGATGGG - Intronic
1119927738 14:78512343-78512365 CAACAAAGGCTGATACAGAAAGG + Intronic
1120458371 14:84760980-84761002 CATCAAATGATCCTACACATTGG + Intergenic
1121511386 14:94515549-94515571 CAGCAAATGCTGCTCCACTTGGG + Intronic
1121879861 14:97490348-97490370 TAACAAATGTTCCTACAGATAGG + Intergenic
1122282893 14:100634660-100634682 CAACACCTGCTGCTACAGGTGGG - Intergenic
1123754981 15:23390550-23390572 CACCAAATGTTGCTAAGGAAGGG - Intergenic
1125000929 15:34769317-34769339 GACAAAATGGTGCTGCAGATAGG + Intergenic
1125224878 15:37384526-37384548 CACCAAATAATGCAAGAGATAGG - Intergenic
1128349450 15:66879479-66879501 CACCAAATGATGCTCCAGGCAGG + Intergenic
1128727095 15:69996273-69996295 CCCCAAATGCTGACACAGAATGG - Intergenic
1130510218 15:84583021-84583043 CTCCAAATGCAGCCACAGAGAGG + Intergenic
1130879166 15:88040370-88040392 CACCAAAGGCTTCTGCAGAATGG - Intronic
1131020677 15:89095321-89095343 CGCCAAATGCTGCTGCAGTTAGG - Intronic
1131619061 15:94047733-94047755 CACCAATTGCTTCCACAGCTTGG - Intergenic
1132112321 15:99110794-99110816 CACCTAATGCTGCAAAAGCTTGG - Intronic
1133979779 16:10624621-10624643 CACCAGATGCAGCTACATTTGGG - Intergenic
1134461395 16:14432446-14432468 CACCAAATGTTGCTAAGGAAGGG + Intergenic
1135906432 16:26516281-26516303 TAACAAATGCTGCCAGAGATTGG + Intergenic
1138457611 16:57130492-57130514 CAATAAATGCTGCTACTTATGGG - Intronic
1138729405 16:59178164-59178186 TCCCAAAGGGTGCTACAGATAGG + Intergenic
1139282533 16:65783102-65783124 CAAAAAATGCTGCTGCAGATGGG + Intergenic
1142612252 17:1115509-1115531 CACTAACTGCAGCCACAGATGGG + Intronic
1147000956 17:37361607-37361629 CACCAAATGCTAAGACAGCTGGG + Intronic
1149360484 17:55889807-55889829 AACCAAATACTGCTAGAGACTGG - Intergenic
1152287844 17:79422771-79422793 CTCCAAATGCAGCTACACAGGGG - Intronic
1154110702 18:11566193-11566215 CTCCAAATGCAGCCACAGAGGGG - Intergenic
1155227754 18:23744494-23744516 CATCAATTGCTGCTAGAGTTGGG + Intronic
1155828276 18:30477855-30477877 TACCAAATCATGCTTCAGATGGG + Intergenic
1157782187 18:50449416-50449438 CACCCATTGCTGCTCCTGATCGG - Intergenic
1158443337 18:57497033-57497055 AACCAAATGTTGCCACATATAGG + Intergenic
1166210929 19:41306147-41306169 CTCCAAATCCTGCTGCAGGTTGG + Intronic
927407426 2:22787126-22787148 CACCAAATGTTACAATAGATTGG - Intergenic
928034376 2:27807999-27808021 CAGCAAATGCTGACACAAATTGG + Intronic
929168504 2:38907389-38907411 CACCAAAGGCAGCTCCAAATTGG + Intronic
932117976 2:69070330-69070352 CTCTAAATGCTGCTCCTGATGGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933070388 2:77850152-77850174 CACCAAATGCTGGTAAGGATGGG + Intergenic
933858851 2:86444037-86444059 CCTCAATTGCTGCTACAGAAGGG - Intronic
935383599 2:102478695-102478717 TACCAGTTCCTGCTACAGATGGG + Intronic
936672034 2:114667684-114667706 GAGTAAATGCTGCTACAGAGGGG + Intronic
937218608 2:120328541-120328563 CACCAGATGCTGTAACAGCTTGG - Intergenic
940191364 2:151043589-151043611 CTCCCAATGCTGCTACATTTAGG - Intronic
940924587 2:159350086-159350108 AACCAAATGCTGGTGCAAATGGG - Exonic
941395552 2:164968813-164968835 CACCCAATGCTGCTCCCGATCGG - Intergenic
943217065 2:185051296-185051318 CACCAAATGCTGATGAGGATGGG - Intergenic
943490535 2:188549487-188549509 CACCAAATGCTGGTAAGAATGGG + Intronic
944130376 2:196341162-196341184 TACCACATGCTGCTATAGTTTGG - Intronic
945005113 2:205396949-205396971 CCACAAAGGCTGCTACAGAAAGG + Intronic
947032987 2:225819381-225819403 AACCAAATGTTGCTACATATTGG + Intergenic
947557790 2:231112295-231112317 CCCCAAAAGCAGCTACAGAAAGG - Intronic
948881165 2:240857879-240857901 CAACAGATGATGCAACAGATGGG + Intergenic
1170882653 20:20310815-20310837 CACCAAATACTGCCACAGCCAGG + Intronic
1175748510 20:61478304-61478326 CACCCATTGCTGCTAGAGACGGG - Intronic
1175875432 20:62227334-62227356 CACCAAATGCTCTTACGGATGGG - Intergenic
1176043720 20:63081697-63081719 CACCTTATTCTGCTACAGCTGGG - Intergenic
1178780744 21:35601351-35601373 CACCAAATGCTGCTCAAGTTTGG - Intronic
1179647033 21:42782373-42782395 CATCAGATGCAGATACAGATGGG - Intergenic
1180905942 22:19411685-19411707 CAACAATTGCTGATATAGATGGG + Intronic
1180984517 22:19896634-19896656 CCCCAAGTCCAGCTACAGATGGG + Intronic
1182720555 22:32395116-32395138 CACCACATGCTGCTCCACTTTGG + Exonic
1184507908 22:44915389-44915411 CATCAAATGCTGGTGCAGTTGGG + Intronic
1184793934 22:46720279-46720301 CACCAAATGCAGCTAATTATAGG + Intronic
950582315 3:13870679-13870701 CTCCAAGTGCTGCTAGAGAAAGG + Intronic
951321222 3:21248463-21248485 CGCCAAATGCTACTAAACATGGG + Intergenic
954203587 3:49040857-49040879 CACCAAATGCTGACACAGATAGG - Intronic
956562465 3:70595389-70595411 CACCAAATGCTGCTATGGAGGGG - Intergenic
957977957 3:87471775-87471797 CGCCTAAGCCTGCTACAGATAGG + Intergenic
958040147 3:88217846-88217868 CACATAATGCTTCTCCAGATGGG - Intergenic
967424024 3:189305414-189305436 CACAAAAAGCAGCTACAGGTTGG - Intronic
967852615 3:194093542-194093564 AAAAAAATGCTGTTACAGATTGG - Intergenic
970240163 4:14001049-14001071 CACCTCATCCTGCTACAGCTGGG + Intergenic
970263515 4:14255133-14255155 CAGCAAATGCTGCTGCACTTTGG - Intergenic
973307283 4:48667171-48667193 CACCCCATCCTGCTACATATGGG - Intronic
975761350 4:77623613-77623635 CACCAAATGCTGTCACTCATTGG + Intergenic
980014463 4:127632904-127632926 CACCAATTGCAGCTAAGGATTGG + Intronic
980256972 4:130394202-130394224 CATCAAATTCTGAAACAGATTGG - Intergenic
980304356 4:131038289-131038311 CACCAAATTCTGCTGGTGATGGG - Intergenic
982540838 4:156668491-156668513 CTCCAAATTCTGCTACATTTAGG + Intergenic
983074841 4:163313546-163313568 CACCAAATGCTGGCAAGGATGGG - Intergenic
983235529 4:165175048-165175070 TACCAAATACTGCTATAGATTGG + Intronic
984941265 4:184934296-184934318 TACCAAGTGCTGGTACAGATGGG + Intergenic
986349635 5:6865847-6865869 CTCCAAATGCTTCTCCAAATAGG + Intergenic
987109118 5:14668208-14668230 CCCCAGATGCTGCTACAGTTCGG + Intronic
990555314 5:56928345-56928367 CACCAAATGCTGGTAAGGATGGG - Intronic
996185683 5:120472065-120472087 TTGCAAATGCTGCTTCAGATTGG + Intronic
996459928 5:123730457-123730479 TAACAAATGCTGGTAAAGATGGG + Intergenic
999170886 5:149594142-149594164 TAACACATGCTGCTACAGAGAGG + Intronic
1002350581 5:178580709-178580731 CACTAAATGCTGCTCAAGAAAGG + Intronic
1002573394 5:180157012-180157034 CACCAAATGCTGGTAAGGAAGGG + Intronic
1002972143 6:2034828-2034850 CACCAAATGCAGAAGCAGATAGG + Intronic
1003138158 6:3448869-3448891 CAGAAAATGTTGCTACAGAGAGG + Intronic
1004921776 6:20382555-20382577 CACCTTATACTGCTACAAATAGG + Intergenic
1004980452 6:21017481-21017503 CCCCAAATACTGCTACAATTAGG - Intronic
1008563484 6:52744731-52744753 CTCCAAATGATGCACCAGATAGG - Intergenic
1008569101 6:52797705-52797727 CTCCAAATGATGCACCAGATGGG - Intronic
1009656833 6:66558370-66558392 CAGCTATTGCTGATACAGATAGG + Intergenic
1010647561 6:78410044-78410066 CAACAAATTCTGGTACAGATGGG + Intergenic
1012422882 6:99084189-99084211 CACCAAAAGCTGCCACACACAGG - Intergenic
1012903249 6:105032399-105032421 TACCAAATGCTGGCAAAGATAGG - Intronic
1017592680 6:155994011-155994033 CACAAAATGCTGATGCAGTTGGG - Intergenic
1018094088 6:160369882-160369904 CACAAAGTGCAGCTTCAGATAGG + Intronic
1024038665 7:45531923-45531945 CACCAAATCCTGCTTTAGAAAGG + Intergenic
1026307843 7:69157663-69157685 CACCAAATACTTCCACTGATGGG - Intergenic
1027794715 7:82678203-82678225 CATCAAAAGCTGCTACAGGCAGG - Intergenic
1027868349 7:83674978-83675000 CACCCATTGCTGCTCCAGATTGG - Intergenic
1027972259 7:85099672-85099694 CACCAAATGCTAATGAAGATAGG - Intronic
1030058234 7:105601881-105601903 AACCAAATGCTGCTGCAAAATGG - Intergenic
1030208378 7:106972681-106972703 CGCCCATTGCTGCTCCAGATCGG - Intergenic
1030224660 7:107136656-107136678 CACCAAATGCTGGTGAACATAGG + Intronic
1031472014 7:122177287-122177309 CACCCATTGCTGCTCCTGATCGG + Intergenic
1032747553 7:134803032-134803054 CTCCAAATGTTGTTAAAGATAGG - Intronic
1036685432 8:10906245-10906267 CACCAAATCCTGCTAAATGTTGG + Intronic
1042253825 8:66783118-66783140 CACCAAATGCTGGTGAGGATAGG - Intronic
1043702973 8:83313431-83313453 CAGCAGAGGCTGCTCCAGATGGG + Intergenic
1046465785 8:114601482-114601504 CACAAAATGCTGGCAAAGATGGG + Intergenic
1047022362 8:120788242-120788264 AACAAAAGGCTGCTACACATTGG + Intronic
1048100242 8:131343134-131343156 CACCCATTGCTGCTCCTGATCGG - Intergenic
1048949136 8:139478621-139478643 CACCAAAAGCTGCTCCAGGCAGG - Intergenic
1050196716 9:3092417-3092439 CACCAAATGCTGATGAGGATGGG + Intergenic
1050471011 9:5989986-5990008 CACATAATGGTGCTACAGTTTGG - Intronic
1055012699 9:71584435-71584457 CATCACATGCTACTACAGACTGG - Intergenic
1057700012 9:97357045-97357067 CACCAAATGTTCCTCCAGAAAGG - Intronic
1058501001 9:105616339-105616361 CACCAAATGTTTCTACTGAGAGG + Intronic
1059227561 9:112686404-112686426 CCCCAGATACTGCTAAAGATGGG + Exonic
1187404511 X:18991029-18991051 CAGGAAATGCTTCTACAGAGAGG - Exonic
1189493697 X:41490494-41490516 CACCAAATGCTGGCAAAGATAGG + Intergenic
1193334268 X:80269383-80269405 TACCAAATGTTGCTGCAGAGAGG - Intergenic
1193814246 X:86085926-86085948 CTCCAACTTCTGTTACAGATTGG + Intergenic
1194412787 X:93577849-93577871 CGCCCACTGCTGCTGCAGATAGG + Intergenic
1201906127 Y:19087208-19087230 CACCTATTGCTGCTCCTGATTGG + Intergenic