ID: 1094261742

View in Genome Browser
Species Human (GRCh38)
Location 12:28508336-28508358
Sequence TTCTGGACTCCTCTTATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094261739_1094261742 -6 Left 1094261739 12:28508319-28508341 CCCTTCTCTGTTCTTTTTTCTGG 0: 1
1: 0
2: 6
3: 111
4: 1448
Right 1094261742 12:28508336-28508358 TTCTGGACTCCTCTTATGCTTGG 0: 1
1: 0
2: 2
3: 7
4: 172
1094261741_1094261742 -7 Left 1094261741 12:28508320-28508342 CCTTCTCTGTTCTTTTTTCTGGA 0: 1
1: 0
2: 5
3: 88
4: 1092
Right 1094261742 12:28508336-28508358 TTCTGGACTCCTCTTATGCTTGG 0: 1
1: 0
2: 2
3: 7
4: 172
1094261738_1094261742 11 Left 1094261738 12:28508302-28508324 CCAACTGATTCTCATCTCCCTTC 0: 1
1: 0
2: 1
3: 36
4: 355
Right 1094261742 12:28508336-28508358 TTCTGGACTCCTCTTATGCTTGG 0: 1
1: 0
2: 2
3: 7
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094261742 Original CRISPR TTCTGGACTCCTCTTATGCT TGG Intronic
900019409 1:178012-178034 TTCTGAAATCCTTTTATGCCTGG - Intergenic
900082482 1:868957-868979 TTCTGAAATCCTTTTATGCCTGG - Intergenic
901681297 1:10914385-10914407 TTCTGGAGTCCCTTTATCCTGGG + Intergenic
902488418 1:16763405-16763427 TTCTGAACTCCTGGGATGCTAGG + Intronic
905045653 1:34998298-34998320 TTCTGGATTTCTCTTCTACTGGG + Intronic
905972731 1:42153823-42153845 TTCTGGCCTCCTCCCATGCAAGG - Intronic
907190774 1:52646302-52646324 TTCTGGACTCTTTCTATTCTAGG - Intronic
907528425 1:55069013-55069035 GTCTTGACTCCTCTCAGGCTGGG + Exonic
910684852 1:89905751-89905773 TTCTGGACTCCTCTCCTGCTGGG - Intronic
915979132 1:160409258-160409280 TTCTGGCCTCCTCTAATTGTTGG - Intronic
917276116 1:173333571-173333593 TTCTTATCTCCTCTTATGATGGG - Intergenic
917445051 1:175099812-175099834 TTCTGTGCTCCTCTTCTACTTGG + Intronic
919792414 1:201300596-201300618 TTGGGGACTCCTCTTCTGCTGGG + Intronic
923532023 1:234819111-234819133 TTCTGAACTCCTGGGATGCTAGG - Intergenic
923555453 1:234997316-234997338 CTCTGGACTCTTTTTCTGCTGGG - Intergenic
1063365263 10:5486708-5486730 TCCTGGACTCCTCTCAAGCCAGG - Intergenic
1063912502 10:10846222-10846244 ATATGGCCTCCTCATATGCTAGG + Intergenic
1064476788 10:15699033-15699055 TCCTGGACTCCCAATATGCTGGG - Intronic
1064991846 10:21263364-21263386 TTCTAGGCTCCTGTTATGTTAGG + Intergenic
1070117166 10:73540240-73540262 TTCCTGGCTCCTCTTATGATAGG - Intronic
1070504355 10:77099855-77099877 TTCTGCACCCCTCTTTTACTGGG + Intronic
1075451187 10:122552919-122552941 GTGTGGACTCCTCTTATGTGTGG + Intergenic
1075855895 10:125630094-125630116 TTCTAGACGCCTCCTCTGCTAGG + Intronic
1076961741 10:133768064-133768086 TTCTGAAATCCTTTTATGCCTGG + Intergenic
1076976015 11:173206-173228 TTCTGAAATCCTTTTATGCCTGG - Intronic
1080351034 11:31386191-31386213 TCCTGGACACGTGTTATGCTGGG + Intronic
1080450377 11:32374451-32374473 TTCTGGCCCGCTCTTTTGCTTGG + Intergenic
1081317957 11:41653763-41653785 TTCTGTATTCCACTAATGCTGGG + Intergenic
1084164422 11:67368464-67368486 CTCTGGACTCCTGGTATCCTGGG - Intronic
1085548434 11:77343645-77343667 TGCTGGACACCTTTTTTGCTGGG - Intronic
1087138062 11:94740280-94740302 GTCTGCCCTCCTCTGATGCTTGG - Intronic
1088562151 11:111126166-111126188 CTCTAAACTCCTCTTATGCATGG + Intergenic
1090222360 11:125039261-125039283 TTCTTGTCTCCATTTATGCTGGG + Intronic
1090309493 11:125722322-125722344 TTCTGGACTCCTTATATGAATGG + Intergenic
1094261742 12:28508336-28508358 TTCTGGACTCCTCTTATGCTTGG + Intronic
1095467123 12:42499119-42499141 TTATGGAGTACTCATATGCTAGG + Intronic
1096871962 12:54598434-54598456 TTCAGGCTTCCTCTGATGCTGGG + Intergenic
1098356561 12:69617890-69617912 TTCTGGACTGCTCTTCTGGAAGG - Intergenic
1102737818 12:115178965-115178987 TTCTGGGCTCCTATTCTACTTGG - Intergenic
1103389089 12:120557353-120557375 TTGTGGACACATCTTCTGCTGGG + Exonic
1103397168 12:120616949-120616971 TTCTGGACTCCTCATATAAATGG + Intergenic
1104145330 12:126028286-126028308 TTCTGGACCCCGATTCTGCTTGG + Intergenic
1106799009 13:33236668-33236690 ATCTTGAGTCCTCTGATGCTGGG + Intronic
1108505510 13:51109039-51109061 TTCTGGACTCCTTTCCAGCTTGG - Intergenic
1111177542 13:84616353-84616375 TAATAGACTCCTCTTTTGCTTGG + Intergenic
1112469599 13:99675592-99675614 TTCTGGACTCTTCATATACATGG + Intronic
1114886447 14:26857796-26857818 TTTTGGTCTCCTCCTATGTTTGG + Intergenic
1117816294 14:59601525-59601547 TTCTGGACACTTCATATGATAGG - Intronic
1118049761 14:62014020-62014042 TTCTGGACTCCACTTGTTCCTGG + Intronic
1118128381 14:62935296-62935318 TGCTACACTCCTGTTATGCTAGG + Intronic
1122289339 14:100671540-100671562 TTCTTGATTCCTCTTCTGCAGGG + Intergenic
1122583171 14:102784509-102784531 TACTGGGCCCCTCTGATGCTTGG + Intronic
1124993282 15:34696812-34696834 TTCTTGTCTCCTTTTCTGCTTGG - Intergenic
1125245950 15:37639781-37639803 TTCTGGTCCCCTTTTATGTTTGG - Intergenic
1126303110 15:47222237-47222259 TTCTGGACATCTCATATGATGGG - Intronic
1129618986 15:77125907-77125929 CTCTGGACTGCTCTTCTCCTGGG - Intronic
1131338006 15:91568947-91568969 TTTTAGACTCCTTTTATGTTAGG + Intergenic
1133539106 16:6731546-6731568 TTCTGGTCTCCTATTGTGCATGG - Intronic
1136671271 16:31860529-31860551 TTCTGGACATGTCTTATGATTGG - Intergenic
1136864583 16:33735702-33735724 TTCTGGATCCCTCTTCTGCAGGG + Intergenic
1136864745 16:33738053-33738075 TTCTGGATCCCTCTTCTGCAGGG + Intergenic
1137368335 16:47880511-47880533 TTCTGGAATCCTCTTCTGTTTGG + Intergenic
1137435016 16:48447786-48447808 TTCTGAGCCCCTGTTATGCTAGG - Intronic
1137511037 16:49101097-49101119 TTCTAGATTCCCCTTATCCTTGG + Intergenic
1138159625 16:54741117-54741139 TCCTGGACTCCCATGATGCTTGG - Intergenic
1140927908 16:79600449-79600471 TTCTCGCCTCCTCTTCTGCTTGG + Exonic
1142444247 16:90124461-90124483 TTCTGAAATCCTTTTATGCCTGG + Intergenic
1142455844 16:90221941-90221963 TTCTGAAATCCTTTTATGCCTGG + Intergenic
1203126076 16_KI270728v1_random:1583838-1583860 TTCTGGATCCCTCTTCTGCAGGG + Intergenic
1203126242 16_KI270728v1_random:1586189-1586211 TTCTGGATCCCTCTTCTGCAGGG + Intergenic
1142463263 17:111016-111038 TTCTGAAATCCTTTTATGCCTGG - Intergenic
1142887959 17:2924899-2924921 TTCTGGTCTCCTCTGAGCCTGGG - Intronic
1148789615 17:50166056-50166078 TTCTGGACTCCTCTCCTCGTGGG + Exonic
1149638205 17:58186741-58186763 TTCTGGACTCCACTTATTGAGGG + Intergenic
1152964552 18:102780-102802 TTCTGAAATCCTTTTATGCCTGG - Intergenic
1153141964 18:1983043-1983065 TTCTGTCCCCCTCTAATGCTGGG - Intergenic
1153407950 18:4761197-4761219 TGCTGGACTCCTCTTGTCCACGG + Intergenic
1154137647 18:11794500-11794522 TTCTGGACATTTCATATGCTTGG - Intronic
1156638156 18:39056019-39056041 TTCTGGCTTCCTCTTGGGCTTGG - Intergenic
1157237893 18:45981280-45981302 TTCTAGAATCCTCTTAAACTTGG - Intergenic
1159342585 18:67155289-67155311 TTCTCTACTCTTCTTTTGCTTGG + Intergenic
1160652979 19:243459-243481 TTCTGAAATCCTTTTATGCCTGG - Intergenic
1162222904 19:9193950-9193972 TTCTGTACTCATCTTTTGCCAGG + Intergenic
1162480692 19:10925381-10925403 TTCTGGAAGCCTCTTTTCCTAGG + Intronic
1168726871 19:58588762-58588784 TTCTGAAATCCTTTTATGCCTGG + Intergenic
1202702780 1_KI270713v1_random:835-857 TTCTGAACTCCTGGGATGCTAGG - Intergenic
934633268 2:95954872-95954894 TTCTGGATCCCTCTTCTGCAGGG + Intronic
934800232 2:97148407-97148429 TTCTGGATCCCTCTTCTGCAGGG - Intronic
936571683 2:113622443-113622465 TTCTGAAATCCTTTTATGCCTGG - Intergenic
938163856 2:129009481-129009503 TTCTTGGCTCCTCTTTTTCTCGG - Intergenic
942282145 2:174376426-174376448 TTTTGGAACCCTCTTATGGTGGG - Intronic
942999095 2:182301890-182301912 TTCTAGATTCCTCTCATCCTTGG - Intronic
943862761 2:192889749-192889771 TTCCTCACTCCTCTAATGCTTGG - Intergenic
944774727 2:202951398-202951420 TCCCAGACTCCTCTTTTGCTAGG - Intronic
947288853 2:228548836-228548858 TTCTGGATTCCTCTTATCTCTGG - Intergenic
949087340 2:242166742-242166764 TTCTGAAATCCTTTTATGCCTGG + Intergenic
1169804852 20:9549088-9549110 TTATCGACTCCTCTTATAATAGG - Intronic
1172050739 20:32115621-32115643 GTTTGAAATCCTCTTATGCTTGG + Intronic
1172632553 20:36388850-36388872 CTCTGGACACCTCTTCTGATGGG - Intronic
1179091193 21:38267277-38267299 TTCTGGACTGCTCTCATTCCAGG + Intronic
1183177544 22:36235393-36235415 TTCTGGACTCCTTTTGTATTTGG - Intronic
1184103728 22:42355366-42355388 GCCTGGACTCCTCTGACGCTAGG - Intergenic
1184355020 22:43974055-43974077 TTCCTGACTCCTCTTGTTCTGGG + Intronic
1184395140 22:44230880-44230902 TTCTGAAATCTTCTTAGGCTGGG - Intergenic
1185428513 22:50788446-50788468 TTCTGAAATCCTTTTATGCCTGG + Intergenic
953622146 3:44542566-44542588 CTCTGAACTTCTCTTATGTTGGG + Intergenic
955460891 3:59182220-59182242 TTCTGACCTCTTCTTATTCTAGG - Intergenic
956025893 3:64982904-64982926 TTGTGTCCTCCTCCTATGCTTGG - Intergenic
956432533 3:69201690-69201712 TTCTGGACTCTTCATATCCGAGG + Intronic
956527198 3:70178220-70178242 TTCTGCTTTTCTCTTATGCTGGG + Intergenic
957180267 3:76868964-76868986 TTCTTGACTCCTTTTTTGGTGGG - Intronic
960736529 3:120786894-120786916 TTTTGGTCTTCTCATATGCTAGG + Intergenic
964288029 3:155142294-155142316 TTCTGGACTCCTTGTAGGTTCGG - Exonic
964380788 3:156097194-156097216 TCCAGGACTTCTCTTTTGCTGGG - Intronic
967795435 3:193593638-193593660 TTCTGGACGCCTCTCAATCTTGG + Intronic
967992670 3:195143056-195143078 TTCTGGACACGAATTATGCTTGG + Intronic
968364865 3:198176579-198176601 TTCTGAAATCCTTTTATGCCTGG + Intergenic
970881559 4:20938264-20938286 TTCTGGGCTCCTCTTTGCCTTGG - Intronic
971171289 4:24235865-24235887 TTCTGCTCTCCTTTTCTGCTTGG - Intergenic
971780507 4:31028232-31028254 TTCTTAAATCCTCTTATTCTAGG - Intronic
972830256 4:42806468-42806490 TTCTGCACTCCTCTAGGGCTGGG + Intergenic
975139053 4:70902158-70902180 TTCTGGTCTCCTCTGCTGCTAGG - Intergenic
976017952 4:80582238-80582260 TTATGAACTCCTCTGATACTCGG + Intronic
979209263 4:118079559-118079581 TTCTGAATTCCTCTCATCCTGGG - Intronic
981489615 4:145325615-145325637 TTCTGGACTCCACTTATGGTGGG + Intergenic
983416284 4:167459394-167459416 TTCTGAACTCCTTATATGCCAGG + Intergenic
985464972 4:190185546-190185568 TTCTGAAATCCTTTTATGCCTGG + Intronic
985876077 5:2596956-2596978 TTCTGGGCTCCTCTTCTAATTGG - Intergenic
986638271 5:9846354-9846376 TTCTGGTCTCCTCATAGTCTGGG + Intergenic
986835375 5:11631325-11631347 TTCTGGACTCCTCTATAGCAAGG + Intronic
987238851 5:15971996-15972018 TTCTGGACTCCCCTTTTCCAGGG - Intergenic
987950296 5:24665796-24665818 TACTTGACTCCTATTAAGCTGGG + Intergenic
994428665 5:99627850-99627872 TTCTGGACTCATCTGGGGCTTGG - Intergenic
994579788 5:101626702-101626724 TTCTGAAATCCTGTTATGCTTGG + Intergenic
996315060 5:122152373-122152395 TTCTGGCCTCCTCAAATGCTTGG - Exonic
998197719 5:140089814-140089836 TTCTGGACTTCCCATTTGCTTGG - Intergenic
999522912 5:152370771-152370793 TTCTCAAGTCCTCTTATTCTAGG + Intergenic
1000220381 5:159209058-159209080 ATGTGGACTCCTCCAATGCTAGG + Intronic
1001253808 5:170168637-170168659 TTCAGGGCTCCTGTTATTCTGGG - Intergenic
1002887952 6:1312530-1312552 TTCCGGAGTCCTCTTCCGCTGGG - Exonic
1003720828 6:8700372-8700394 TTCTTTATTCCTCTTATGCATGG - Intergenic
1006337342 6:33427679-33427701 TCCTGGGCTCCTCCTCTGCTGGG + Intronic
1007666838 6:43519003-43519025 TACTAGACTTCTGTTATGCTTGG - Intronic
1008495757 6:52132513-52132535 TTCTGGACTCCTCCACTGCAGGG + Intergenic
1012217452 6:96604982-96605004 TGCTGCACTCCTCATGTGCTGGG - Intronic
1013306705 6:108854329-108854351 TTCTGCACTGGTCTTCTGCTTGG - Exonic
1015628358 6:135205120-135205142 TTCTGGGTTCCTCTTATGTCTGG - Intronic
1016193784 6:141305513-141305535 TTCTGGTTTTCTCTTATTCTTGG + Intergenic
1019251324 7:14309-14331 TTCTGAAATCCTTTTATGCCTGG - Intergenic
1019348053 7:540062-540084 CTCTGGAATCCTCTTGTCCTTGG - Intergenic
1019860536 7:3654271-3654293 GTCTGAACTGCTCTTATCCTGGG + Intronic
1022143463 7:27513772-27513794 TTCTGGTCTCCTGCTATGGTGGG + Intergenic
1023699742 7:42881426-42881448 TTCTGGACTCCTCTTCCTATTGG - Intergenic
1024891858 7:54212431-54212453 TTCTGGAACCCTCCTGTGCTTGG - Intergenic
1027251058 7:76398972-76398994 TCCTGGACTCCTCTAAAGCACGG + Intronic
1028098452 7:86791063-86791085 TACTGAACACCTTTTATGCTTGG - Intronic
1030250892 7:107442927-107442949 TTATAGACTCCTCTCAAGCTTGG - Intronic
1030628594 7:111870757-111870779 TTGTGGAATCCTCTTAGGCTGGG - Intronic
1031277641 7:119750063-119750085 TTCTGGACTTCTTATATGCAAGG - Intergenic
1032882432 7:136103720-136103742 TTGTGGATTCCCCTTGTGCTTGG + Intergenic
1034389814 7:150777141-150777163 TTTTGGAGTCTTCTTATCCTTGG + Intergenic
1035497386 8:64598-64620 TTCTGAAATCCTTTTATGCCTGG - Intergenic
1035512501 8:203171-203193 TTCTGAAATCCTTTTATGCCTGG - Intergenic
1037357227 8:18034135-18034157 TTCTGGACTTCTCTTTGGCATGG + Intergenic
1038255287 8:25945595-25945617 TTCTGTAGACCTCTTCTGCTTGG + Intronic
1044068183 8:87723538-87723560 TTCTGGACTCCACTCAGCCTCGG - Intergenic
1045246762 8:100448824-100448846 TTCAGGACTGCTGTCATGCTGGG + Intergenic
1045747998 8:105446327-105446349 TTCTGGCTTACTCTTATGATGGG + Intronic
1046965814 8:120164321-120164343 TTATGGATTCATCTTATGGTAGG - Intronic
1048203822 8:132399877-132399899 TTCTTAACTCCTCTGATGCCTGG - Intronic
1052951438 9:34216428-34216450 TTCTGGACACCTCATATGAATGG + Intronic
1056665198 9:88576315-88576337 TTCTCGACTCCTTTTATACCTGG + Intronic
1057052975 9:91939864-91939886 TTCTGGAGCCCTCTTTTGGTGGG - Intronic
1058581802 9:106466708-106466730 TTCTGAGATTCTCTTATGCTAGG - Intergenic
1060106280 9:120875607-120875629 TTCAGGCCTCATCTTTTGCTTGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062749235 9:138239461-138239483 TTCTGAAATCCTTTTATGCCTGG + Intergenic
1188331710 X:28880477-28880499 TTAAGTACTCCTCTTTTGCTAGG - Intronic
1193476098 X:81967889-81967911 TCCTGGCCTGCTCTTATGCCAGG + Intergenic
1194745884 X:97627889-97627911 TTCTAGCCTCCTCATAGGCTTGG - Intergenic
1195095196 X:101494616-101494638 TTCTGGACTCATCTTCAACTGGG - Exonic
1200884358 Y:8253371-8253393 TTCCGGACTCCTCTTGCTCTAGG + Intergenic