ID: 1094266792

View in Genome Browser
Species Human (GRCh38)
Location 12:28568738-28568760
Sequence CAGGGTCTCCATTTTTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094266792_1094266798 23 Left 1094266792 12:28568738-28568760 CCTCCTTAAAAATGGAGACCCTG 0: 1
1: 0
2: 2
3: 22
4: 229
Right 1094266798 12:28568784-28568806 CTAATCCAGGATTACACAGATGG 0: 1
1: 0
2: 0
3: 10
4: 185
1094266792_1094266797 10 Left 1094266792 12:28568738-28568760 CCTCCTTAAAAATGGAGACCCTG 0: 1
1: 0
2: 2
3: 22
4: 229
Right 1094266797 12:28568771-28568793 AATTTAATGGCTTCTAATCCAGG 0: 1
1: 0
2: 1
3: 10
4: 184
1094266792_1094266796 -3 Left 1094266792 12:28568738-28568760 CCTCCTTAAAAATGGAGACCCTG 0: 1
1: 0
2: 2
3: 22
4: 229
Right 1094266796 12:28568758-28568780 CTGTTATTCAGAGAATTTAATGG 0: 1
1: 0
2: 0
3: 41
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094266792 Original CRISPR CAGGGTCTCCATTTTTAAGG AGG (reversed) Intronic
900214432 1:1473857-1473879 CAGAGTTTCCCTGTTTAAGGAGG + Intronic
902391165 1:16107674-16107696 CAGGTTCTCCTTTTGTAATGGGG - Intergenic
902824768 1:18965481-18965503 CAGCGTCTCCATGTGTAAGATGG - Intergenic
903008958 1:20317228-20317250 CAGGGTCTCCACTTTCCATGTGG - Intronic
907500825 1:54878701-54878723 CTGGGTCTCAATTTTTTAGATGG - Intronic
907642562 1:56206114-56206136 CAGTGACTCCGGTTTTAAGGTGG - Intergenic
907679287 1:56548656-56548678 CAGAGTATGCATTTTTAGGGGGG - Intronic
907825233 1:58010224-58010246 CAGTGTCTGCATCTCTAAGGTGG - Intronic
908871384 1:68616770-68616792 CTGTATCTCCCTTTTTAAGGAGG - Intergenic
909302733 1:74033866-74033888 CAGGGTGTCCATTTTGAAGTAGG - Intronic
909476794 1:76089933-76089955 CAGTGTCTCCATTTATAAAATGG - Intronic
910320952 1:85943298-85943320 CAGGGTCTCCAGTTTGCAGATGG + Intronic
910454617 1:87384150-87384172 CAGGGTCTACATTTAGAAGCAGG + Intergenic
910529883 1:88223773-88223795 CAGGGTCTTCATTTGTAAGAGGG + Intergenic
913205454 1:116534388-116534410 CAGGCTTCCCGTTTTTAAGGTGG - Intronic
916253607 1:162763499-162763521 TAGAGTTTGCATTTTTAAGGGGG + Intronic
916354237 1:163886228-163886250 CAGTGTCCTCATTTTTAAGTGGG + Intergenic
916552293 1:165860451-165860473 CAGGGTCTCACTTTTTGAGACGG + Intronic
916635327 1:166662006-166662028 CAGGGTCTCCATCTTGCAGATGG + Intergenic
916966736 1:169954036-169954058 CAACATCTCCATTTTGAAGGTGG + Exonic
918305686 1:183243944-183243966 CATGTTCTCCATTTTCAAGCTGG + Exonic
918585223 1:186179412-186179434 CAAGGTCTCAATTCTTAAGTGGG - Intronic
918960402 1:191268773-191268795 CAGAGACTCTATTTTAAAGGAGG - Intergenic
922603104 1:226871554-226871576 CAGGTTCTCCATTTGTAAATAGG - Intronic
922619393 1:226980828-226980850 CAGGGCCTCCATTCTCAGGGCGG + Intronic
923682782 1:236132351-236132373 CAAGGTTTCCATTTTTTAAGGGG + Intergenic
924382799 1:243479977-243479999 CAGGTTCTCCATTTGTAAAATGG - Intronic
924580231 1:245317125-245317147 CAGGATGTCTATTTTTAAGCAGG - Intronic
1063064330 10:2593092-2593114 CAGTGTCTACATCTTTAATGGGG + Intergenic
1063196241 10:3746597-3746619 TAGCGTCTTCATGTTTAAGGTGG - Intergenic
1063498417 10:6531106-6531128 CAGGATTTGCATTTTTAAAGAGG - Intronic
1065492828 10:26299347-26299369 CATGGTCTCCATTTTGAACCGGG + Intronic
1065554344 10:26899984-26900006 CTGGGTCTCCACTTGTAAGATGG + Intergenic
1067731260 10:48813062-48813084 CAGGGGCTCAGTTTCTAAGGAGG - Intronic
1068044191 10:51864099-51864121 CAGGACTTCCAGTTTTAAGGTGG + Intronic
1068445685 10:57119509-57119531 CAGTGTCTCCATTTGTAACGTGG - Intergenic
1068799586 10:61124999-61125021 CACTGTCTCCATTTTTACTGAGG + Intergenic
1070526900 10:77303074-77303096 CAGTTTCTCCATGTTTGAGGTGG + Intronic
1070836876 10:79453083-79453105 CAGGGTTCTCATTTTTATGGTGG - Intergenic
1070842450 10:79496695-79496717 CAGAGTGTCCATCTTTAAGGAGG - Intergenic
1073170387 10:101502017-101502039 CATGGGCACCATTTTTAATGGGG - Intronic
1073768420 10:106708780-106708802 CTGCTTCTCCACTTTTAAGGTGG + Intronic
1074857576 10:117484633-117484655 CAGGGGTTCCATGTTAAAGGAGG + Intergenic
1076615163 10:131750110-131750132 CCGGGTGTCCACTTTCAAGGAGG - Intergenic
1077448484 11:2617398-2617420 CAGGATCTCCTTTTTTAATGCGG + Intronic
1077514129 11:2991790-2991812 CAGGCTTCCCGTTTTTAAGGTGG - Intronic
1081808763 11:45903749-45903771 CAGCCTCTCCATTTTAGAGGGGG + Intronic
1082266680 11:50126690-50126712 CTGGGTCTCCAGTTTTCAGGTGG + Intergenic
1082289409 11:50351878-50351900 CTGGGTCTCCAGTTTTCAGGTGG - Intergenic
1082787101 11:57323344-57323366 CAGGGTCTCCATGTTTTTGTGGG - Intronic
1083152262 11:60799121-60799143 CAGTGTCTCCATCTGTAAAGTGG + Intronic
1083264834 11:61541940-61541962 CAGTGTCTCCACCTTTTAGGGGG + Intronic
1083611547 11:64006811-64006833 TAGCGTCTCCATTTTGCAGGTGG - Intronic
1084555104 11:69871567-69871589 CTCTGTCTCCATATTTAAGGTGG - Intergenic
1084595453 11:70114173-70114195 CTGTTTCTCCATCTTTAAGGTGG - Intronic
1085340319 11:75727171-75727193 CAGGCTCTTCATTTGTAAAGTGG - Intronic
1086079714 11:82890564-82890586 GAGGGTTCCCATTTTTAAGATGG - Intronic
1086452982 11:86935343-86935365 CAGGGTCTCAGTGTTTAATGCGG + Intronic
1088823823 11:113477149-113477171 CAGTTTCTCCATTTTTAAGTGGG + Intergenic
1090577763 11:128126245-128126267 CAGGGACTCCAGCTTGAAGGAGG + Intergenic
1090851056 11:130570916-130570938 CAGGGTCACCATTCTGAGGGCGG + Intergenic
1093865441 12:24221784-24221806 CAGGATCTGCAATTTTAAGCAGG + Intergenic
1094266792 12:28568738-28568760 CAGGGTCTCCATTTTTAAGGAGG - Intronic
1096468499 12:51862076-51862098 CAGGGTCTCCATTTCACAGATGG - Intergenic
1098231459 12:68375694-68375716 CAGGATCTCCAGCTTGAAGGGGG - Intergenic
1100130335 12:91484920-91484942 CTGGGTCTCCATTTCCAAGATGG + Intergenic
1101437610 12:104677591-104677613 CAGGGTGTCCATTTGAAAGTGGG + Intronic
1102641035 12:114366790-114366812 GTGGGTGTCCATCTTTAAGGTGG + Intronic
1104051971 12:125201160-125201182 GAGGGTCTGCATATTTCAGGGGG + Intronic
1106792262 13:33167680-33167702 CAGTGTCTCCATGATTAAGAAGG - Intronic
1109142556 13:58733435-58733457 CAGGGTCTCCAGTTTGCAGATGG - Intergenic
1112468030 13:99661903-99661925 CAGGGGCACAATTTATAAGGGGG - Intronic
1113654078 13:112057320-112057342 CTGGGTCGCCATTTTTGGGGAGG + Intergenic
1114396118 14:22363185-22363207 CAGGGTCTCCATTTTTTGTGGGG + Intergenic
1114596222 14:23914445-23914467 GAGGGTTTCCCTTTCTAAGGAGG - Intergenic
1115391362 14:32857882-32857904 CAGTTGCTCCATTTTTAAAGTGG - Intergenic
1117902791 14:60552336-60552358 CAGTGTCTTTATTTTTAAAGTGG + Intergenic
1118260815 14:64245001-64245023 CAGGGTTTTAAATTTTAAGGCGG + Intronic
1120707055 14:87756059-87756081 CCAGTTCTCCATTTTTAAAGTGG - Intergenic
1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG + Intronic
1121419291 14:93801205-93801227 CAGTTTCTCCATTTGTAAGATGG + Intergenic
1121832367 14:97063318-97063340 CAGTGTCTCCATCTTTAAATGGG + Intergenic
1122074119 14:99224722-99224744 CAGTGTCCCCATTTTACAGGTGG + Intronic
1123135453 14:106023404-106023426 CAGGATCTCCATGTTCAAAGAGG + Intergenic
1123852017 15:24367704-24367726 CGGGGTCCCCATTTCTGAGGGGG + Intergenic
1129581578 15:76817231-76817253 CAGGATCTCCTTTTTAAAGGTGG - Intronic
1129786850 15:78315390-78315412 CTGTGTCTGCATTTTAAAGGGGG + Intergenic
1130426468 15:83806068-83806090 CAGTGGCTCCAGTTTCAAGGTGG - Intronic
1137529328 16:49267385-49267407 CAGGGGCTCCATTTTAAACATGG + Intergenic
1137781985 16:51105216-51105238 CAGCTTCTCCATTTTTAAAGTGG + Intergenic
1140589880 16:76338793-76338815 CAGTCTCTTCATGTTTAAGGTGG + Intronic
1143794452 17:9325491-9325513 CAGGGTTCCCATGTTAAAGGGGG + Intronic
1144787395 17:17839685-17839707 GAGGGGATCCATTTTTCAGGGGG + Intergenic
1149389818 17:56177263-56177285 CACGGGGTCCATGTTTAAGGGGG + Intronic
1150298861 17:64031558-64031580 TAGGGTCTCCATTAGTAAGAGGG + Intergenic
1150314759 17:64159195-64159217 CAGGGACTCCATTGCAAAGGGGG - Intronic
1150523008 17:65889236-65889258 CAGGGAGTCCATTTTAGAGGTGG - Intronic
1150714944 17:67564267-67564289 CAGGGTCTCCAACTTGCAGGTGG - Intronic
1150743024 17:67794892-67794914 CAGAGTCTCCCTCTGTAAGGAGG - Intergenic
1151825114 17:76519665-76519687 CAGAGTCTCCACTTTCGAGGGGG - Intergenic
1156026856 18:32664417-32664439 CAGGGTCTCCTTTGCTGAGGGGG + Intergenic
1156082959 18:33362218-33362240 CAGGCTCTCCATTTTTTATAAGG - Intronic
1156198448 18:34802918-34802940 GAGGGTGTCCAATTTTAAAGAGG - Intronic
1158038956 18:53069559-53069581 CAGTGACTGCATTTCTAAGGTGG + Intronic
1160816944 19:1040445-1040467 CAGTTTCTCCATTTGTAAGACGG - Intronic
1164954471 19:32370052-32370074 CAGGCTCTCCCTTTTTAAGGCGG + Intronic
1165705812 19:37975494-37975516 CAGGGTCCCCATCTGTAAGATGG + Intronic
1167999836 19:53436270-53436292 CAGAGTCTCCATGTTGAAAGGGG + Intronic
925921559 2:8641610-8641632 CCCGGCCTCCATATTTAAGGGGG - Intergenic
926044402 2:9699068-9699090 CAGTGTCCCCATTTTAAAGAGGG + Intergenic
927942467 2:27113669-27113691 CAGGTTCTCCATCTGTAATGCGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
934588426 2:95526283-95526305 CAGGGTCTTGATCTTGAAGGAGG + Intergenic
936494256 2:113004452-113004474 CAGGGTCTCCAGCTTGCAGGTGG - Intergenic
937621286 2:123990659-123990681 CAGGGTCTTCATCTTTAAAAAGG + Intergenic
937865642 2:126749541-126749563 CAGTGTCTCCATCTTTAAAATGG + Intergenic
937865783 2:126750965-126750987 CAGTGTCTCCATCTTTAAAATGG - Intergenic
939390867 2:141568477-141568499 CAGAGTCTTCATTTTTTGGGTGG - Intronic
939801468 2:146716295-146716317 CAAGGTCTCTTTTTTTAGGGAGG + Intergenic
941032931 2:160533505-160533527 CAGGTTCTCCATTATTTATGTGG - Intergenic
942564479 2:177252712-177252734 TAGAGCCTCCGTTTTTAAGGAGG - Intronic
943792677 2:191952104-191952126 CAGGGTCTCTATCTTGAAAGTGG + Intronic
946798442 2:223382778-223382800 CACGGCCTCCTTTTTTAAGAAGG - Intergenic
1169561748 20:6809039-6809061 CAGAGTTTCCATTTTTAAAATGG + Intergenic
1171179498 20:23082097-23082119 CATGGTCTCCAGTTTTCAGTTGG - Exonic
1174276937 20:49410660-49410682 CAGTTTCTTCATTTATAAGGTGG + Intronic
1174699171 20:52590475-52590497 CAGTTTCTTCATTTGTAAGGTGG + Intergenic
1174847001 20:53952060-53952082 CAGTGTCTCCATTCTCAAAGTGG + Intronic
1175060393 20:56236846-56236868 CAGTGTCTCCATCTGTAAAGTGG + Intergenic
1175263775 20:57690559-57690581 CGGGGTCTCCATTGCTATGGCGG + Intronic
1176744764 21:10641365-10641387 CAGGATCTCCATGTCCAAGGAGG + Intergenic
1177228263 21:18285298-18285320 CAGGATGTCCATTTGTAAGTGGG + Intronic
1178513195 21:33224698-33224720 CAGTGTCTCTATATTTAAAGTGG + Intergenic
1178662612 21:34520290-34520312 CAGGGTCTCCACTTGCAAAGAGG - Intronic
1179511029 21:41873742-41873764 CAGAGTTTCCATTTTTAAGATGG - Intronic
1182044957 22:27267096-27267118 CAGGGTCTCTGTTCCTAAGGAGG - Intergenic
1184514861 22:44955720-44955742 CAGAGTCTCCAGTTTCCAGGTGG + Intronic
1184532373 22:45064401-45064423 CAGGGTCCTCATTTTTAAAGGGG - Intergenic
1184990140 22:48161959-48161981 CAGACCCTTCATTTTTAAGGTGG + Intergenic
949204787 3:1424961-1424983 TACTGTCTCCATTTTTAAGCTGG - Intergenic
949498262 3:4654117-4654139 CGGGGTCTCCATTTCTAAGTTGG + Intronic
950396131 3:12735489-12735511 CAGGGTCTTCATTTAGAAAGAGG - Intronic
952039139 3:29240844-29240866 CATTGTCTTTATTTTTAAGGAGG - Intergenic
952518416 3:34129360-34129382 AAGATTCTCCAATTTTAAGGAGG + Intergenic
952709719 3:36417205-36417227 CAGGGTATCATGTTTTAAGGAGG - Intronic
952824558 3:37514208-37514230 AAGGGTGCCCATTTTTCAGGTGG + Intronic
956013496 3:64856804-64856826 CAGGGTAGCCATATTTAATGAGG - Intergenic
956760746 3:72441943-72441965 CAGGGTATCTAAATTTAAGGGGG + Intronic
956908569 3:73793182-73793204 CTGGGTCTCCAGCTTTCAGGTGG + Intergenic
960617790 3:119612258-119612280 CAGGGTCTGCTTTTTGTAGGGGG + Intronic
963995376 3:151702388-151702410 CAGGTTCTCCTTTTGTAATGGGG + Intergenic
964705895 3:159618133-159618155 CAGTTTCCCCATATTTAAGGTGG - Intronic
966641526 3:182196401-182196423 CAGTGTCCCCATTTGTAAAGTGG - Intergenic
967384760 3:188900427-188900449 CTGGGTCTCCATTTTTTACAGGG - Intergenic
969475614 4:7421022-7421044 CCGGGTCTCCATCTCCAAGGAGG - Intronic
969559799 4:7939741-7939763 CCGGGGCTCCATTGTTAAGGCGG - Exonic
970921098 4:21396251-21396273 CAGGATCCTCATTTTTAAGAAGG - Intronic
971060918 4:22968484-22968506 CAGGATCTTCATCTTTAAGATGG - Intergenic
972272539 4:37524968-37524990 CAGGGTGTCCAGATTTAAGATGG + Intronic
976194232 4:82517736-82517758 CAGGGTCTCCATCTTGCAGATGG + Intronic
978735695 4:112081745-112081767 CAGAGTGTCCATTTCTAATGGGG + Intergenic
981260500 4:142712926-142712948 CAGGCTCTCCATATATCAGGTGG + Intronic
983115098 4:163805704-163805726 CAAGGTCTGCATTTTTAAAGAGG - Intronic
985086215 4:186315598-186315620 CTGCCTCTCCAATTTTAAGGCGG - Intergenic
985237278 4:187889742-187889764 CTGGGCCTCCATTCTTAATGTGG - Intergenic
986414859 5:7518514-7518536 CAGAGTCTTTATTTTTAAAGAGG + Intronic
986735239 5:10663159-10663181 CAGGGTCCTCATTTGTAAAGTGG + Intergenic
986977348 5:13409725-13409747 CAGTGGCTCCACTTTTAAGACGG - Intergenic
991362777 5:65838206-65838228 CAGTATCTACATTTGTAAGGAGG + Intronic
991612106 5:68460026-68460048 GATGGTCTCCTTTTTTATGGTGG + Intergenic
992341331 5:75826551-75826573 CATGGGCTCCATTTACAAGGAGG - Intergenic
993566734 5:89485681-89485703 CAGGGGCACCATATTTGAGGTGG - Intergenic
995518322 5:112976249-112976271 GAGGGTATCCATTTTGGAGGTGG - Intergenic
998639090 5:143989184-143989206 CAGGTCATCCATTTTTAAGAAGG + Intergenic
1000160953 5:158597333-158597355 TAGGGTGGCCATTTTTAATGGGG - Intergenic
1001921368 5:175602487-175602509 CAGTGTCTTCATTTGTAAAGTGG + Intergenic
1002672301 5:180877908-180877930 CAGGATCTTCTTTTCTAAGGTGG + Intergenic
1002928081 6:1616537-1616559 AGGGGTCTCCGTTTCTAAGGCGG + Intergenic
1003669906 6:8147568-8147590 CAGAGTCCCCATTTATAATGTGG + Intergenic
1005088118 6:22027757-22027779 CAGTTTCTCCATTTGTAAAGTGG + Intergenic
1007727898 6:43927707-43927729 CAGTTTCTCCATTTACAAGGAGG + Intergenic
1007772644 6:44203457-44203479 CAGGATTTCCATTCTTAAAGGGG + Intergenic
1008036326 6:46749180-46749202 CAGAGTCTCCATTGTGTAGGTGG - Intronic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1012003025 6:93678327-93678349 CAAAGTATCCTTTTTTAAGGGGG - Intergenic
1013093116 6:106919348-106919370 CAGTGTCTCCATTTTACAGAGGG + Intergenic
1015280891 6:131433081-131433103 CAGGGTGTCCATTCTAAAGATGG - Intergenic
1015955013 6:138589905-138589927 CAGTGTCTTCATTTGTGAGGTGG - Intronic
1017774651 6:157671326-157671348 CAGGGTCTTCATTTGTGAAGAGG + Intronic
1017899980 6:158711452-158711474 CAGGGTCTCCAGTTTGCAGATGG - Intronic
1019075320 6:169382513-169382535 CAGGGTTCTAATTTTTAAGGAGG + Intergenic
1019408450 7:896096-896118 CACGGTATCCCTTTTTAAAGCGG - Exonic
1021140743 7:17021688-17021710 TAAAGTCTCTATTTTTAAGGGGG + Intergenic
1021149598 7:17133422-17133444 CAGGATCTCCCTTTTAAAGGTGG - Intergenic
1021217234 7:17931972-17931994 TTGGGGGTCCATTTTTAAGGAGG - Intronic
1021432892 7:20581822-20581844 CAAGGTCTGCATTTTTTAGAGGG + Intergenic
1022102113 7:27174826-27174848 CAGGTTCGCCACTTTTGAGGAGG - Intronic
1022158258 7:27681961-27681983 CAAGATCTCCCTTTTTAAGGTGG - Intergenic
1022339816 7:29457346-29457368 CATGGTCTCCCTTTCCAAGGAGG - Intronic
1024113359 7:46169728-46169750 CAGTTTCTCCATTCATAAGGTGG - Intergenic
1024990769 7:55233277-55233299 CAGGGCCTGCATTCTGAAGGCGG - Intronic
1026391311 7:69905420-69905442 CAGGGTCTCCATCTTGCAGATGG - Intronic
1027456738 7:78401774-78401796 TATTGTCTCCATTTTTAAAGAGG - Intronic
1028777558 7:94696158-94696180 CTGTGTCTTCATATTTAAGGTGG + Intergenic
1028925573 7:96354084-96354106 CTGGGTATGTATTTTTAAGGTGG - Intergenic
1029131660 7:98335963-98335985 CATGATTTCCCTTTTTAAGGAGG - Intronic
1030057740 7:105598154-105598176 AAGGTTCTCCATTTTTAAAATGG - Intronic
1030265290 7:107614837-107614859 TAGGGTCTCTATTTTTGAGACGG - Intronic
1030550232 7:110949108-110949130 CAGGGTCTCCAGCTTGCAGGTGG + Intronic
1031552159 7:123128412-123128434 CAGGGTCTTCATCTGTAAGATGG - Intronic
1032501320 7:132402394-132402416 CAGGGGCTCCATTGTAAAGGTGG + Intronic
1033365022 7:140666460-140666482 CAGAGTCTCCAGGTTTAAAGGGG - Intronic
1034132160 7:148729453-148729475 TAGGCACTCCCTTTTTAAGGAGG - Intronic
1035607730 8:940016-940038 CGGGATCTCCGTCTTTAAGGTGG + Intergenic
1036952727 8:13156832-13156854 CAAGGTTTCCATTTTCAAAGGGG - Intronic
1041108562 8:54465179-54465201 CAGGGTCTGAATTCTTGAGGAGG + Intergenic
1042539446 8:69893509-69893531 CAGTTTTTACATTTTTAAGGAGG - Intergenic
1042848603 8:73192884-73192906 CTGTGTTTCTATTTTTAAGGTGG - Intergenic
1045084122 8:98662338-98662360 GAGGGTCTCCATTTTTTTGCTGG - Intronic
1045403070 8:101837930-101837952 CAGGGTCTTCATGTTTAAAGAGG - Intronic
1045783090 8:105890649-105890671 CAGGGTCTCCATTTGTCACCTGG - Intergenic
1045945025 8:107785639-107785661 TAGGGTCCCCAGGTTTAAGGTGG + Intergenic
1045963438 8:107996259-107996281 TAGGGTCTTCATGCTTAAGGTGG - Intronic
1046817576 8:118601652-118601674 CTGGGTCCCCATTCTTAGGGAGG - Intronic
1047111748 8:121797265-121797287 CTGGGTCTCCATTTTCCAAGGGG - Intergenic
1047694705 8:127391879-127391901 CAGTTTCTCCATTTGTAAAGTGG - Intergenic
1048193169 8:132308771-132308793 CAGTATCTCCATTGTTAAAGTGG - Intronic
1049777204 8:144412251-144412273 CAGGGTCTCCATATCAAAGAGGG + Intronic
1050997641 9:12240262-12240284 CAAAGTCTGGATTTTTAAGGTGG + Intergenic
1051792836 9:20827554-20827576 CAGGATCTCCTTTTTTAAGGGGG - Intronic
1054867562 9:70018102-70018124 CCGAGTCTGAATTTTTAAGGAGG + Intergenic
1055217837 9:73888516-73888538 AAGGGTAACCATTTTTAAGCTGG + Intergenic
1055909152 9:81327311-81327333 CAGGGGCTTCAATTTTAAGACGG + Intergenic
1058090939 9:100804667-100804689 AAGTTTCTCCACTTTTAAGGGGG - Intergenic
1060234102 9:121850293-121850315 TAGGGTCTCCACTTTAAAGATGG - Intronic
1060956546 9:127644989-127645011 CAGGGTCTTCAGTATTACGGAGG + Intronic
1061794642 9:133078899-133078921 CAGAGTCTCCAGATTTAAAGGGG + Intronic
1062263260 9:135674027-135674049 GTGGGTTTCCATTTTTAAGTTGG - Intergenic
1185761529 X:2692466-2692488 CCGGGTCTCTATTTTTAGGGAGG + Intronic
1185913667 X:4010364-4010386 CTGGGTCTCCAGCTTTCAGGTGG - Intergenic
1186539528 X:10386310-10386332 AAGAGTCTCCATCTTCAAGGAGG + Intergenic
1187581189 X:20609198-20609220 AAGTGGTTCCATTTTTAAGGAGG + Intergenic
1187723263 X:22174002-22174024 CAGGTTCTCCATCTTTGGGGTGG + Intronic
1189632509 X:42969920-42969942 CAGGGTCTCCACTCCTGAGGGGG - Intergenic
1190457808 X:50642780-50642802 CTGGTTCTCCATTTGTAAAGTGG - Intronic
1191011156 X:55760926-55760948 CACTGTCTCCATTTTGAAGATGG + Intergenic
1191682343 X:63854095-63854117 ATGAGCCTCCATTTTTAAGGAGG + Intergenic
1192016122 X:67333509-67333531 CAGGTTCTTCATTTTTAAAATGG - Intergenic
1192703333 X:73499784-73499806 CATGGTCTCAGTTTTTCAGGAGG - Intergenic
1195579558 X:106485647-106485669 CAGGGTCTCCAAGTCTGAGGAGG + Intergenic
1196863912 X:120053030-120053052 GAGGCTCTCCAAATTTAAGGTGG + Intergenic
1196879187 X:120183300-120183322 GAGGCTCTCCAAATTTAAGGTGG - Intergenic
1198435760 X:136615531-136615553 TAAGGCCTCCATTTTCAAGGTGG - Intergenic
1198665526 X:139018150-139018172 CTGGGTCTCCATTTTATAAGAGG - Intronic