ID: 1094268872

View in Genome Browser
Species Human (GRCh38)
Location 12:28589222-28589244
Sequence CCTTTCTAACAGATGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094268865_1094268872 26 Left 1094268865 12:28589173-28589195 CCTTCTGAGAAACAAGGGTGTAG No data
Right 1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094268872 Original CRISPR CCTTTCTAACAGATGGAGAA GGG Intergenic
No off target data available for this crispr