ID: 1094272018

View in Genome Browser
Species Human (GRCh38)
Location 12:28627338-28627360
Sequence GTTGAGAAGAAGAATGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094272013_1094272018 28 Left 1094272013 12:28627287-28627309 CCAAAAGAAAGTAGAGAAACGAC No data
Right 1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG No data
1094272015_1094272018 4 Left 1094272015 12:28627311-28627333 CCAGATTGACCGCTAAAGAAGGT No data
Right 1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG No data
1094272016_1094272018 -5 Left 1094272016 12:28627320-28627342 CCGCTAAAGAAGGTGACAGTTGA No data
Right 1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094272018 Original CRISPR GTTGAGAAGAAGAATGAGTA GGG Intergenic
No off target data available for this crispr