ID: 1094274070

View in Genome Browser
Species Human (GRCh38)
Location 12:28648733-28648755
Sequence ACATTAACACAACTATCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094274070_1094274071 26 Left 1094274070 12:28648733-28648755 CCAAAAGATAGTTGTGTTAATGT No data
Right 1094274071 12:28648782-28648804 TATTTTAGTTCTGTAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094274070 Original CRISPR ACATTAACACAACTATCTTT TGG (reversed) Intergenic