ID: 1094284486

View in Genome Browser
Species Human (GRCh38)
Location 12:28777602-28777624
Sequence AACAAATGCTAGGGCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094284486_1094284490 22 Left 1094284486 12:28777602-28777624 CCAGTGAGGCCCTAGCATTTGTT No data
Right 1094284490 12:28777647-28777669 AGCTGTCAAAACTAAAATTCAGG No data
1094284486_1094284491 23 Left 1094284486 12:28777602-28777624 CCAGTGAGGCCCTAGCATTTGTT No data
Right 1094284491 12:28777648-28777670 GCTGTCAAAACTAAAATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094284486 Original CRISPR AACAAATGCTAGGGCCTCAC TGG (reversed) Intergenic