ID: 1094284487

View in Genome Browser
Species Human (GRCh38)
Location 12:28777611-28777633
Sequence GTTGAACTCAACAAATGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094284487_1094284492 22 Left 1094284487 12:28777611-28777633 CCCTAGCATTTGTTGAGTTCAAC No data
Right 1094284492 12:28777656-28777678 AACTAAAATTCAGGGAGCCAAGG No data
1094284487_1094284493 23 Left 1094284487 12:28777611-28777633 CCCTAGCATTTGTTGAGTTCAAC No data
Right 1094284493 12:28777657-28777679 ACTAAAATTCAGGGAGCCAAGGG No data
1094284487_1094284491 14 Left 1094284487 12:28777611-28777633 CCCTAGCATTTGTTGAGTTCAAC No data
Right 1094284491 12:28777648-28777670 GCTGTCAAAACTAAAATTCAGGG No data
1094284487_1094284490 13 Left 1094284487 12:28777611-28777633 CCCTAGCATTTGTTGAGTTCAAC No data
Right 1094284490 12:28777647-28777669 AGCTGTCAAAACTAAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094284487 Original CRISPR GTTGAACTCAACAAATGCTA GGG (reversed) Intergenic