ID: 1094284489

View in Genome Browser
Species Human (GRCh38)
Location 12:28777633-28777655
Sequence TTGACAGCTGAAAAATAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094284489_1094284494 11 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284494 12:28777667-28777689 AGGGAGCCAAGGGCCTGTGCAGG No data
1094284489_1094284491 -8 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284491 12:28777648-28777670 GCTGTCAAAACTAAAATTCAGGG No data
1094284489_1094284495 12 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284495 12:28777668-28777690 GGGAGCCAAGGGCCTGTGCAGGG No data
1094284489_1094284492 0 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284492 12:28777656-28777678 AACTAAAATTCAGGGAGCCAAGG No data
1094284489_1094284493 1 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284493 12:28777657-28777679 ACTAAAATTCAGGGAGCCAAGGG No data
1094284489_1094284490 -9 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284490 12:28777647-28777669 AGCTGTCAAAACTAAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094284489 Original CRISPR TTGACAGCTGAAAAATAAAA TGG (reversed) Intergenic