ID: 1094284491

View in Genome Browser
Species Human (GRCh38)
Location 12:28777648-28777670
Sequence GCTGTCAAAACTAAAATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094284488_1094284491 13 Left 1094284488 12:28777612-28777634 CCTAGCATTTGTTGAGTTCAACC No data
Right 1094284491 12:28777648-28777670 GCTGTCAAAACTAAAATTCAGGG No data
1094284487_1094284491 14 Left 1094284487 12:28777611-28777633 CCCTAGCATTTGTTGAGTTCAAC No data
Right 1094284491 12:28777648-28777670 GCTGTCAAAACTAAAATTCAGGG No data
1094284489_1094284491 -8 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284491 12:28777648-28777670 GCTGTCAAAACTAAAATTCAGGG No data
1094284486_1094284491 23 Left 1094284486 12:28777602-28777624 CCAGTGAGGCCCTAGCATTTGTT No data
Right 1094284491 12:28777648-28777670 GCTGTCAAAACTAAAATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094284491 Original CRISPR GCTGTCAAAACTAAAATTCA GGG Intergenic