ID: 1094284492

View in Genome Browser
Species Human (GRCh38)
Location 12:28777656-28777678
Sequence AACTAAAATTCAGGGAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094284487_1094284492 22 Left 1094284487 12:28777611-28777633 CCCTAGCATTTGTTGAGTTCAAC No data
Right 1094284492 12:28777656-28777678 AACTAAAATTCAGGGAGCCAAGG No data
1094284489_1094284492 0 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284492 12:28777656-28777678 AACTAAAATTCAGGGAGCCAAGG No data
1094284488_1094284492 21 Left 1094284488 12:28777612-28777634 CCTAGCATTTGTTGAGTTCAACC No data
Right 1094284492 12:28777656-28777678 AACTAAAATTCAGGGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094284492 Original CRISPR AACTAAAATTCAGGGAGCCA AGG Intergenic