ID: 1094284493

View in Genome Browser
Species Human (GRCh38)
Location 12:28777657-28777679
Sequence ACTAAAATTCAGGGAGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094284487_1094284493 23 Left 1094284487 12:28777611-28777633 CCCTAGCATTTGTTGAGTTCAAC No data
Right 1094284493 12:28777657-28777679 ACTAAAATTCAGGGAGCCAAGGG No data
1094284488_1094284493 22 Left 1094284488 12:28777612-28777634 CCTAGCATTTGTTGAGTTCAACC No data
Right 1094284493 12:28777657-28777679 ACTAAAATTCAGGGAGCCAAGGG No data
1094284489_1094284493 1 Left 1094284489 12:28777633-28777655 CCATTTTATTTTTCAGCTGTCAA No data
Right 1094284493 12:28777657-28777679 ACTAAAATTCAGGGAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094284493 Original CRISPR ACTAAAATTCAGGGAGCCAA GGG Intergenic