ID: 1094286558

View in Genome Browser
Species Human (GRCh38)
Location 12:28800854-28800876
Sequence TCCTTATCTCCAAAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094286558_1094286568 10 Left 1094286558 12:28800854-28800876 CCCTCCCTCTTTGGAGATAAGGA No data
Right 1094286568 12:28800887-28800909 AAGTACATTGGGTATAGAAAGGG No data
1094286558_1094286569 26 Left 1094286558 12:28800854-28800876 CCCTCCCTCTTTGGAGATAAGGA No data
Right 1094286569 12:28800903-28800925 GAAAGGGCACCTGTCCCCTGAGG No data
1094286558_1094286567 9 Left 1094286558 12:28800854-28800876 CCCTCCCTCTTTGGAGATAAGGA No data
Right 1094286567 12:28800886-28800908 GAAGTACATTGGGTATAGAAAGG No data
1094286558_1094286563 -2 Left 1094286558 12:28800854-28800876 CCCTCCCTCTTTGGAGATAAGGA No data
Right 1094286563 12:28800875-28800897 GACCCTAAGGAGAAGTACATTGG No data
1094286558_1094286564 -1 Left 1094286558 12:28800854-28800876 CCCTCCCTCTTTGGAGATAAGGA No data
Right 1094286564 12:28800876-28800898 ACCCTAAGGAGAAGTACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094286558 Original CRISPR TCCTTATCTCCAAAGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr