ID: 1094295936

View in Genome Browser
Species Human (GRCh38)
Location 12:28904883-28904905
Sequence GGTTTTCTGAAGAAAATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094295934_1094295936 -5 Left 1094295934 12:28904865-28904887 CCTCTTGAGATTTCGAATGGTTT No data
Right 1094295936 12:28904883-28904905 GGTTTTCTGAAGAAAATGGTAGG No data
1094295930_1094295936 23 Left 1094295930 12:28904837-28904859 CCTTATGTTACTCAAATGCTAGG No data
Right 1094295936 12:28904883-28904905 GGTTTTCTGAAGAAAATGGTAGG No data
1094295929_1094295936 28 Left 1094295929 12:28904832-28904854 CCAGTCCTTATGTTACTCAAATG No data
Right 1094295936 12:28904883-28904905 GGTTTTCTGAAGAAAATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094295936 Original CRISPR GGTTTTCTGAAGAAAATGGT AGG Intergenic
No off target data available for this crispr