ID: 1094297961

View in Genome Browser
Species Human (GRCh38)
Location 12:28928896-28928918
Sequence GCCTGTGTATGGAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094297953_1094297961 7 Left 1094297953 12:28928866-28928888 CCCTGACCCCATCAAAGATAATG No data
Right 1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG No data
1094297951_1094297961 11 Left 1094297951 12:28928862-28928884 CCTCCCCTGACCCCATCAAAGAT No data
Right 1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG No data
1094297955_1094297961 1 Left 1094297955 12:28928872-28928894 CCCCATCAAAGATAATGCTCTTA No data
Right 1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG No data
1094297952_1094297961 8 Left 1094297952 12:28928865-28928887 CCCCTGACCCCATCAAAGATAAT No data
Right 1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG No data
1094297954_1094297961 6 Left 1094297954 12:28928867-28928889 CCTGACCCCATCAAAGATAATGC No data
Right 1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG No data
1094297957_1094297961 -1 Left 1094297957 12:28928874-28928896 CCATCAAAGATAATGCTCTTATG No data
Right 1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG No data
1094297956_1094297961 0 Left 1094297956 12:28928873-28928895 CCCATCAAAGATAATGCTCTTAT No data
Right 1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094297961 Original CRISPR GCCTGTGTATGGAGTGGAGA GGG Intergenic
No off target data available for this crispr