ID: 1094300101

View in Genome Browser
Species Human (GRCh38)
Location 12:28955010-28955032
Sequence TCAATTTTCAAGGTCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094300101_1094300104 -9 Left 1094300101 12:28955010-28955032 CCTTCCATGACCTTGAAAATTGA No data
Right 1094300104 12:28955024-28955046 GAAAATTGACCTTTGAGTTGCGG No data
1094300101_1094300105 -3 Left 1094300101 12:28955010-28955032 CCTTCCATGACCTTGAAAATTGA No data
Right 1094300105 12:28955030-28955052 TGACCTTTGAGTTGCGGAGCAGG No data
1094300101_1094300106 -2 Left 1094300101 12:28955010-28955032 CCTTCCATGACCTTGAAAATTGA No data
Right 1094300106 12:28955031-28955053 GACCTTTGAGTTGCGGAGCAGGG No data
1094300101_1094300110 25 Left 1094300101 12:28955010-28955032 CCTTCCATGACCTTGAAAATTGA No data
Right 1094300110 12:28955058-28955080 GGTCATAGTCACCAAGATGATGG No data
1094300101_1094300107 -1 Left 1094300101 12:28955010-28955032 CCTTCCATGACCTTGAAAATTGA No data
Right 1094300107 12:28955032-28955054 ACCTTTGAGTTGCGGAGCAGGGG No data
1094300101_1094300109 4 Left 1094300101 12:28955010-28955032 CCTTCCATGACCTTGAAAATTGA No data
Right 1094300109 12:28955037-28955059 TGAGTTGCGGAGCAGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094300101 Original CRISPR TCAATTTTCAAGGTCATGGA AGG (reversed) Intergenic
No off target data available for this crispr