ID: 1094306862

View in Genome Browser
Species Human (GRCh38)
Location 12:29029711-29029733
Sequence AAGTATAAGAATAAACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094306862_1094306865 17 Left 1094306862 12:29029711-29029733 CCATCCAGTTTATTCTTATACTT No data
Right 1094306865 12:29029751-29029773 TTAAAACACAGTTCTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094306862 Original CRISPR AAGTATAAGAATAAACTGGA TGG (reversed) Intergenic
No off target data available for this crispr