ID: 1094311358

View in Genome Browser
Species Human (GRCh38)
Location 12:29087063-29087085
Sequence CGTGCACACGGCTGCACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094311358_1094311361 8 Left 1094311358 12:29087063-29087085 CCACATGTGCAGCCGTGTGCACG No data
Right 1094311361 12:29087094-29087116 CAGCCTCAACCCCCCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094311358 Original CRISPR CGTGCACACGGCTGCACATG TGG (reversed) Intergenic