ID: 1094311370

View in Genome Browser
Species Human (GRCh38)
Location 12:29087126-29087148
Sequence TCCACGCATGTGCCCATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094311368_1094311370 -9 Left 1094311368 12:29087112-29087134 CCAGGCCTCACACATCCACGCAT No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data
1094311364_1094311370 -1 Left 1094311364 12:29087104-29087126 CCCCCTTGCCAGGCCTCACACAT No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data
1094311362_1094311370 6 Left 1094311362 12:29087097-29087119 CCTCAACCCCCCTTGCCAGGCCT No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data
1094311367_1094311370 -4 Left 1094311367 12:29087107-29087129 CCTTGCCAGGCCTCACACATCCA No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data
1094311366_1094311370 -3 Left 1094311366 12:29087106-29087128 CCCTTGCCAGGCCTCACACATCC No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data
1094311359_1094311370 28 Left 1094311359 12:29087075-29087097 CCGTGTGCACGTGTGCAGCCAGC No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data
1094311365_1094311370 -2 Left 1094311365 12:29087105-29087127 CCCCTTGCCAGGCCTCACACATC No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data
1094311363_1094311370 0 Left 1094311363 12:29087103-29087125 CCCCCCTTGCCAGGCCTCACACA No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data
1094311360_1094311370 10 Left 1094311360 12:29087093-29087115 CCAGCCTCAACCCCCCTTGCCAG No data
Right 1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094311370 Original CRISPR TCCACGCATGTGCCCATAGC TGG Intergenic
No off target data available for this crispr