ID: 1094311915

View in Genome Browser
Species Human (GRCh38)
Location 12:29093341-29093363
Sequence GATGCTGGTGACCTACAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094311915_1094311921 12 Left 1094311915 12:29093341-29093363 CCCAACTGTAGGTCACCAGCATC No data
Right 1094311921 12:29093376-29093398 TAGAAAAAAAAACACAAGATGGG No data
1094311915_1094311922 13 Left 1094311915 12:29093341-29093363 CCCAACTGTAGGTCACCAGCATC No data
Right 1094311922 12:29093377-29093399 AGAAAAAAAAACACAAGATGGGG No data
1094311915_1094311920 11 Left 1094311915 12:29093341-29093363 CCCAACTGTAGGTCACCAGCATC No data
Right 1094311920 12:29093375-29093397 GTAGAAAAAAAAACACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094311915 Original CRISPR GATGCTGGTGACCTACAGTT GGG (reversed) Intergenic
No off target data available for this crispr