ID: 1094312848

View in Genome Browser
Species Human (GRCh38)
Location 12:29104437-29104459
Sequence CTGAAAACACAAAAGAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094312848_1094312849 -1 Left 1094312848 12:29104437-29104459 CCAAGGTTCTTTTGTGTTTTCAG No data
Right 1094312849 12:29104459-29104481 GCTCCTGAACAGTTTGCTGTAGG No data
1094312848_1094312851 2 Left 1094312848 12:29104437-29104459 CCAAGGTTCTTTTGTGTTTTCAG No data
Right 1094312851 12:29104462-29104484 CCTGAACAGTTTGCTGTAGGTGG No data
1094312848_1094312852 3 Left 1094312848 12:29104437-29104459 CCAAGGTTCTTTTGTGTTTTCAG No data
Right 1094312852 12:29104463-29104485 CTGAACAGTTTGCTGTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094312848 Original CRISPR CTGAAAACACAAAAGAACCT TGG (reversed) Intergenic
No off target data available for this crispr