ID: 1094314748

View in Genome Browser
Species Human (GRCh38)
Location 12:29127290-29127312
Sequence ATGTTCTTCTTAAGGTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094314748_1094314754 -3 Left 1094314748 12:29127290-29127312 CCATATGACCTTAAGAAGAACAT No data
Right 1094314754 12:29127310-29127332 CATGTATTGGCCGGGCGCGGTGG 0: 3
1: 33
2: 282
3: 2063
4: 9732
1094314748_1094314757 25 Left 1094314748 12:29127290-29127312 CCATATGACCTTAAGAAGAACAT No data
Right 1094314757 12:29127338-29127360 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1094314748_1094314759 28 Left 1094314748 12:29127290-29127312 CCATATGACCTTAAGAAGAACAT No data
Right 1094314759 12:29127341-29127363 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1094314748_1094314753 -6 Left 1094314748 12:29127290-29127312 CCATATGACCTTAAGAAGAACAT No data
Right 1094314753 12:29127307-29127329 GAACATGTATTGGCCGGGCGCGG No data
1094314748_1094314756 24 Left 1094314748 12:29127290-29127312 CCATATGACCTTAAGAAGAACAT No data
Right 1094314756 12:29127337-29127359 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094314748 Original CRISPR ATGTTCTTCTTAAGGTCATA TGG (reversed) Intergenic
No off target data available for this crispr