ID: 1094316588

View in Genome Browser
Species Human (GRCh38)
Location 12:29142730-29142752
Sequence AGGTTTAAACAAGTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094316588_1094316591 21 Left 1094316588 12:29142730-29142752 CCTTTCTCCACTTGTTTAAACCT No data
Right 1094316591 12:29142774-29142796 CAAAACAATCCTTTAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094316588 Original CRISPR AGGTTTAAACAAGTGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr