ID: 1094316591

View in Genome Browser
Species Human (GRCh38)
Location 12:29142774-29142796
Sequence CAAAACAATCCTTTAACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094316589_1094316591 14 Left 1094316589 12:29142737-29142759 CCACTTGTTTAAACCTTCAGTTT No data
Right 1094316591 12:29142774-29142796 CAAAACAATCCTTTAACCCTAGG No data
1094316588_1094316591 21 Left 1094316588 12:29142730-29142752 CCTTTCTCCACTTGTTTAAACCT No data
Right 1094316591 12:29142774-29142796 CAAAACAATCCTTTAACCCTAGG No data
1094316590_1094316591 1 Left 1094316590 12:29142750-29142772 CCTTCAGTTTTATCTTGTCTAAT No data
Right 1094316591 12:29142774-29142796 CAAAACAATCCTTTAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094316591 Original CRISPR CAAAACAATCCTTTAACCCT AGG Intergenic
No off target data available for this crispr